To address the “pseudopositive problem” and to minimize the “pseudopositive” signal the primers were designed by Yaku et al. in 2008 with a 3’ nucleotide matching the template plus 2 mismatch nucleotides.
Additionally, Yaku et al. showed that selecting a primer having a 3’ terminal nucleotide that recognizes the SNP nucleotide and the next two nucleotides that form mismatch pairings with the template sequence, can be used as an allele-specific primer to eliminate the pseudopositive problem.
Using primers for the human ABO genes, the researchers demonstrated that this primer design is also useful for detecting a single base pair difference in gene sequences with a signal-to-noise ratio of at least 45.
However, the literature citing experimental data indicates that the proper design of primer DNA sequences is important for the efficient detection of SNP by PCR. Allele-specific primers are usually designed to complement template DNA and contain a nucleotide specific to the SNP at the 3’ end.
The SNP-specific nucleotide forms a base pairing or mismatch pairing depending on the base pair identity of the SNP. Only a proper base pairing at the end of the primer/template duplex will produce a PCR product. Less PCR products are produced for terminal mismatch pairings due to decreased DNA polymerase binding and inefficiencies in the incorporation of 2’-deoxyribonucleoside triphosphates. However, undesired primer extension with mismatched DNA primers can occur during the PCR reaction under unsuitable reaction conditions when the proper amplification cycle, reaction time, temperature, and 2’-deoxyribonucleoside triphosphate concentrations are not optimized. This is called the “pseudopositive problem” that can also arise due to specific DNA primer sequences. Primer extension reactions are often observed when a single mismatch is formed at the 3’ end with the primer. When SNP typing is used to distinguish homozygotes and heterozygotes, this problem becomes more serious since the pseudopositive signal should be less than 1% of those obtained with matched primers. Therefore, allele-specific primers have been designed so that the 3’ end nucleotide was specific to the SNP and the 3rd nucleotide from the 3’ end was mismatched with the template DNA (Kambaraet al., 2004). Another research group developed primers so that the 2nd nucleotide from the 3’ end was specific to the SNP and the 3rd nucleotide from the 3’ end was mismatched with the template DNA (Aono et al., 2000). Methods using locked nucleic acids (LNA), phosphorothioate-modified primer, and dideoxynucleotide-terminated primer have been reported.
Example for the Location of Primers for Lambda DNA:
Sequence from Enterobacteria phage HK629, complete genome:
Variants
Forward Primer
GATCCGGCGCGTGAGTTCACCATGATTCAGTCAGCACCGCTGATGCTGCTGGCTGACCCTGATGAGTTCGTGTCCGTACAACTGG
5’-GATGAGTTCGTGTCCGTACAACX3X2X1
3’-CTACTCAAGCACAGGCATGTTGACC
Taq Polymerase ->
X1 = A, T, or C; X2X3 = CA, CT, CC, AA, AT, AC, TA, TT, OR TC
CGTAATCATGGCCCTTCGGGGCCATTGTTTCTCTGTGGAGGAGTCCATGACGAAAGATGAACTGATTGCCCGTCT
CCGCTCGCTGGGTGAACAACTGAACCGTGATGTCAGCCTGACGGGGACGAAAGAAGAACTGGCGCTCCGTGTGGCAGAGC
TGAAAGAGGAGCTTGATGACACGGATGAAACTGCCGGTCAGGACACCCCTCTCAGCCGGGAAAATGTGCTGACCGGACAT
GAAAATGAGGTGGGATCAGCGCAGCCGGATACCGTGATTCTGGATACGTCTGAACTGGTCACGGTCGTGGCACTGGTGAA
3’-AGTCGCGFCGGCCTATGGCACTAAG-5’
<- Taq Polymerase
5’-GAATCACGGTATCCGGCTGCGCTGA-3’
Reverse Primer
Primers for ABO Genotyping Using Exon 6 of the ABO Gene
www.ncbi.nlm.nih.gov/books/NBK2267/
Sequences of exon 6 of the ABO gene
ABO gene Sequence (5’-3’) (Underlined nucleotides, the G and the A, are the 22
nd nucleotide in the AB allele and the O allele, respectively).
A allele
1 TAGGAAGGAT GTCCTCGTGG TGACCCCTTG GCTGGCTCCC
B allele
41 ATTGTCTGGG AGGGCACATT CAACATCGAC ATCCTCAACG
81 AGCAGTTCAG GCTCCAGAAC ACCACCATTG GGTTAACTGT
121 GTTTGCCATC AAGAA
O allele
1 TAGGAAGGAT GTCCTCGTGG TACCCCTTGG CTGGCTCCCA
41 TTGTCTGGGA GGGCACATTC AACATCGACA TCCTCAACGA
81 GCAGTTCAGG CTCCAGAACA CCACCATTGG GTTAACTGTG
121 TTTGCCATCA AGAA
The selected target for human blood genotyping was the 22nd base pair in exon 6 of the ABO. This base pair is a G/C base pair in the A and B alleles and an A/T base pair in the O allele due to deletion of the G/C base pair found in the A and B alleles.
The 22nd, base pair in exon 6 is the homo G/C base pair for blood type AB and the homo A/T base pair for blood type O.
A two-step PCR was carried out to detect allelic difference in the 22nd base pair of exon 6 of the ABO gene.
1st PCR:
A fragment of exon 6 in human genomic DNA was amplified by using a forward primer (5’-TAGGAAGGATGTCCTCG-3’) complementary to base pairs 1–17 and a reverse primer (5’-TTCTTGATGGCAAACACAGTTAAC-3’) complementary to base pairs 112–135 of the A and B alleles or base pairs 111–134 of the O allele on exon 6.
PCR reaction was carried out in 20 µL reactions using the LightCycler FastStart DNA Master SYBR Green I reaction kit with 0.5 ng/mL of genomic DNA, 1.25 mM MgCl2, and 1 mM of each of the forward and reverse primers. Following denaturation at 95ºC for 10 min, 50 cycles of denaturation at 95ºC for 10 seconds, annealing at 52ºC for 10 seconds, and extension at 72ºC for 10 seconds were carried out on the LightCycler. Amplification was monitored in real time by measuring the fluorescent intensity of SYBR Green I, and amplifications were confirmed to be completed by the 50th cycle with the amount of amplification product being almost identical for both alleles.
2nd PCR:
ABO genotyping with allele-allele-specific primers was carried out using the product of the 1st PCR as a template and the allele-specific forward primers given in Table 3 (5’-TAGGAAGGATGTCCTCGTGY3Y2G-3’) in the 2nd PCR.
The 3’ end nucleotide of the primers is G, which is complementary to the C of the 22nd G/C base pair of exon 6 in the A and B alleles but is mismatched with the A/T base pair at base pair 22 of the O allele. The 2nd and 3rd nucleotides from the 3’ end, Y2 and Y3, respectively, are designed to be mismatched with the 20th and 21st nucleotides of the exon 6 sequence.
The reverse primer used for the 2nd PCR was 5’-TTCTTGATGGCAAACACAGTTAACC-3’. The PCR mixtures (20 µL) contained 2 µL of the 1st PCR product diluted 1000-times, 1.25mM MgCl2 , 1mM of each of the forward and reverse primers.
Following DNA denaturation at 95ºC for 10 min, the 2nd PCR was carried out for 21–28 cycles of denaturation at 95ºC for 10 seconds, annealing at 52ºC for 10 seconds, and extension at 72ºC for 10 seconds.
Schematics of the Detection of a Single Base Pair Difference in Exon 6 of the ABO Gene.
(Source: Yaku et al., 2008)
Allele-specific forward primers used for the detection of single base pair difference in the AB allele and the O allele:
Allele’ specific primer Sequence (5’-3’)a)
ABO261’
AAG TAGGAAGGATGTCCTCGTGAAG
ABO261’
ACG TAGGAAGGATGTCCTCGTGACG
ABO261’
AGG TAGGAAGGATGTCCTCGTGAGG
ABO261’
CAG TAGGAAGGATGTCCTCGTGCAG
ABO261’
CCG TAGGAAGGATGTCCTCGTGCCG
ABO261’
CGG TAGGAAGGATGTCCTCGTGCGG
ABO261’
TAG TAGGAAGGATGTCCTCGTGTAG
ABO261’
TCG TAGGAAGGATGTCCTCGTGTCG
ABO261’
TGG TAGGAAGGATGTCCTCGTGTGG
a) Underlined nucleotides are unpaired with the AB allele and the O allele
PCR
After initial denaturation at 95ºC for 10 min, the amplification was carried out for 20 or 30 cycles as follows in a LightCycler (Roche Diagnostics) thermal cycler: denaturation at 95ºC for 10 seconds, annealing at 58ºC for 10 seconds, and DNA extension at 72ºC for 10 seconds. The 20-µL PCR mixtures were prepared using the LightCycler FastStart DNA Master SYBR Green I reaction kit (Roche Diagnostics, with 1 ng/mL lambda DNA, 1.25mM MgCl2, 1 mM forward primer, and 1 mM reverse primer).PCR products were analyzed by electrophoreses on 3% agarose gel.
SNP Info:
Single nucleotide polymorphisms (SNPs) are gene polymorphisms that occur at circa 0.1% in the human genome, and more than three million SNP have been identified so far. Several associations of SNP types with diseases including diabetes, cancer, and myocardial infarction, and SNP in the human genome. SNPs are also known to influence other aspects of human health such as blood group type and the sensitivity to alcohol. Several techniques for SNP genotyping are available.
These include:
- DNA hybridization,
- Primer extension reaction using allele-specific DNA primers
- The use of DNA polymerase
- The use of DNA mismatch-recognizing enzymes
- The Invader assay
- DNA chips
- Pyrosequencing
The use of allele-specific primers has the advantage of being efficient in cost, reaction time, and simplicity of handling.
SNP genotyping can be achieved by detecting the amounts of PCR products or by detecting the pyrophosphate generated during PCR depending on the identities of the base pairs in the SNP and the template DNA.
Six AS-PCR reverse primers were evaluated for their discriminating power: a wild-type or mutant DNA primer with an additional 3’ subterminal mismatch (underlined) (5’-CTAGTTTGGTCTGGGCTTGTTG/A-3’) and two wild-type or mutant 3’ LNA (bold) primers (5’-CTAGTTTGGTCTGGGCTTGTCG/A-3’ and 5’-CTAGTTTGGTCTGGGCTTGTTG/A-3’).
Fig.1.Amplification plots of mutant plasmid using different AS-PCR Primers: mutant (rectangle), wild-type (triangle), DNA primer(green), 3'LNA primer (blue),and 3' LNA primer with 3' sub terminal mismatch (red) (replicates are show). (For interpretation of the references to color in this figure legend, the reader is referred to the web version)
Morandi et al. report the design of a novel assay that was called “Allele Specific Locked Nucleic Acid quantitative PCR” (ASLNAqPCR). The assay uses LNA-modified allele specific primers and LNA-modified beacon probes to increase sensitivity, specificity and to accurately quantify mutations. Primers specific for codon 12/13 KRAS mutations and BRAF V600E were designed and the assay was validated with 300 routine samples from a variety of sources, including cytology specimens.
Primers used:
Schematics of the Assay
Figure 1. Diagram illustrating ASLNAqPCR. Left side: a single mismatch of the modified primer does not allow PCR amplification. Right side: in case of a perfect match, the Taq polymerase extends the DNA stand and the amplicon is detected by the internal LAN modified beacon probe.
The research group presents “a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD) markers. These markers proved highly efficient primers for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA) base. They “demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII) markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles of 16 chromosome-specific COSII markers and to assign eight of the twelve linkage groups to consensus Solanum chromosomes. The conclusion: The method based on individual allelic variants allows for a level-of-magnitude higher resolution of genetic variation than conventional marker techniques”. They showed “that the majority of monomorphic molecular marker fragments from organisms with reduced heterozygosity levels still contain SNPs that are sufficient to trace individual alleles.”