Live Chat Support Software
800.227.0627

Primer and Probe Collection for 2019 Coronavirus Detection

The new coronavirus (2019-nCoV) first detected in Wuhan City, Hubei Province, China, has infected tens of thousands of people in China. The virus is spreading from person-to-person in almost all parts of the world. The alarming fast transmission of this virus resulted in the World Health Organization (WHO) declaring a global health emergency on 30 January 2020. As of April 29, 2002, a total of 981,246 infections and 55,258 deaths have been reported in the US alone. 

Coronaviruses are a large family of viruses that are common in many animals, including camels, cattle, cats, and bats. However, some animal coronaviruses can infect people and spread between people, for example, MERSSARS, and now 2019-nCoV (or SARS-CoV-2 or COV19) {CDC}.

Xu et al. recently (in February 2020) compared the sequences of animal-to-human transmitted Human Coronaviruses: SARS-CoV-2, SARS-CoV and MERS-CoV.

SARS-CoV-2 was isolated from the respiratory epithelium of a patient with unexplained pneumonia symptoms in the Wuhan seafood market where the coronavirus outbreak occurred. The genomic comparison revealed that the genomes of SRA-Cov-2 and SARS-CoV are extremely homologous at the nucleotide level. Xu et al. identified six regions of difference (RD) in the genome sequence between SARS-CoV and SRSR-CoV-2. RD1, 448 nucleotides in size, RD2, 55 nucleotides in size, and RD3, 278 nucleotides in size, are partial coding sequences of the orf 1ab gene. RD4, 315 nucleotides long, and RD5, 80 nucleotides long, are partial coding sequences of the S gene. RD6, 214 nucleotides in size, is part of the coding sequence of the orf7b and orf8 genes.


Megha Satyanarayana reported in CEN March 2/9 2020 that the CDC’s coronavirus test kit used for the diagnosis of the SARS-CoV-2 was plagued with problems. The accuracy of the testing kit was cast into doubt since it gave inconclusive readouts. According to CDC officials, positive SARS-CoV-2 tests at the state level must be confirmed by the CDC. Therefore, the careful design and validation of all probes used for the detection of RNA sequences of all selected coronaviruses is a necessity. Positive and negative controls will also need to work accurately. Hence, there appears to be a need for primer and probe sets that accurately detect the newly emerged coronavirus SARS-CoV-2 (COV19).    

Reference

Xu J, Zhao S, Teng T, Abdalla AE, Zhu W, Xie L, Wang Y, Guo X. Systematic Comparison of Two Animal-to-Human Transmitted Human Coronaviruses: SARS-CoV-2 and SARS-CoV. Viruses. 2020 Feb 22;12(2):244. [PMC]

Corona virus outbreaks in January 2020. 



Source: Wikimedia Commons


Probes are labeled with a reporter fluorophore such as 6-carboxyfluorescein (FAM), usually on the 5'-end, and a quencher molecule, such as carboxytetramethylrhodamine (TAMRA), usually at the 3'-end.

Genome: Wuhan seafood market pneumonia virus isolate 2019-nCoV/USA-AZ1/2020, complete genome  Sequence ID: MN997409.1 Length: 29882

Note: A, Adenine; C, Cytosine; G, Guanine; T, Thymine; U, Uracil; R, A or G; Y, C or T; S, G or C; W, A or T; K, G or T; M, A or C; B, C or G or T; D, A or G or T; V, A or C or G; N,  any base.

 CDC Primer and Probes

Name

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

Working Conc. [μM]

 

 

N Protein

 

 

2019-nCoV_N1-F

 

GACCCCAAAATCAGCGAAAT

28287------------28306

 

 

2019-nCoV_N1-R

 

TCTGGTTACTGCCAGTTGAATCTG

28358---------------28335

 

20

2019-nCoV_N1-P

FAM

ACCCCGCATTACGTTTGGTGGACC

28309---------------28332

BHQ1

5

2019-nCoV_N2-F

 

TTACAAACATTGGCCGCAAA

29164-------------29183

 

20

2019-nCoV_N2-R

 

GCGCGACATTCCGAAGAA

29230------------29213

 

20

2019-nCoV_N2-P

FAM

ACAATTTGCCCCCAGCGCTTCAG

29188---------------29210

BHQ1

5

2019-nCoV_N3-F

 

GGGAGCCTTGAATACACCAAAA

28681--------------28702

 

20

2019-nCoV_N3-R

 

TGTAGCACGATTGCAGCATTG

28752--------------28732

 

20

2019-nCoV_N3-P

FAM

AYCACATTGGCACCCGCAATCCTG

28706--------------28727 

BHQ1

5

 

Name

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

Working Conc. [μM]

 

 

RNAse Protein

 

 

RP-F

 

AGATTTGGACCTGCGAGCG

 

20

RP-R

 

GAGCGGCTGTCTCCACAAGT

 

 

RP-P RNAse P

FAM

TTCTGACCTGAAGGCTCTGCGCG

BHQ-1

5

 

Name

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

Working Conc. [μM]

 

 

ORF1ab

 

 

2019-nCoV-OFP

 

CCCTGTGGGTTTTACACTTAA

13342------------13362

 

0.6

2019-nCoV-ORP

 

ACGATTGTGCATCAGCTGA

13460------------13442

 

0.8

2019-nCoV-OP

FAM

CCGTCTGCGGTATGTGGAAAGGTTATGG

13377-------------------13404

BBQ1

0.1

 

 

Nucleoprotein- protein N

 

 

2019-nCoV-NFP

 

GGGGAACTTCTCCTGCTAGAAT

28881-------------28902

 

0.6

2019-nCoV-NRP

 

CAGACATTTTGCTCTCAAGCTG

28979-------------28958

 

0.8

2019-nCoV-NP

FAM

TTGCTGCTGCTTGACAGATT

28934-------------28953

TAMRA

0.1

 

 

ORF1b-nsp14

 

 

HKU-ORF1b-nsp14F

 

TGGGGYTTTACRGGTAACCT

18778-----------18797

 

0.6

HKU- ORF1b-nsp14R

 

AACRCGCTTAACAAAGCACTC

18909-------------18889

 

0.8

HKU-ORF1b-nsp141P

FAM

TAGTTGTGATGCWATCATGACTAG

18849---------------18872

TAMRA

0.1

 

 

Nucleoprotein – Protein N

 

 

HKU-NF

 

TAATCAGACAAGGAACTGATTA

29145--------------29166

 

0.6

HKU-NR

 

CGAAGGTGTGACTTCCATG

29254-----------29236

 

0.8

HKU-NP

FAM

GCAAATTGTGCAATTTGCGG

29196------------29177

TAMRA

0.1

 

Positive Control for insertion into plasmid

AGTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTG

AAGAGAAGTTTAAGGAAGGTGTAGAGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTAT

GTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTT

ACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCT

 

Name

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

Working Conc. [μM]

 

 

RNA-dependent RNA polymerase

 

 

RdRP_SARSr-F2

 

GTGARATGGTCATGTGTGGCGG

15431-------------15452

2019-nCoV genome

 

0.6

RdRP_SARSr-R1

 

CARATGTTAAASACACTATTAGCATA

15460-----------------15435

Coronavirus BtRs-BetaCoV/YN2018D, complete genome. Sequence ID: MK211378.1 Length: 30213

 

0.8

RdRP_SARSr-P1

FAM

CCAGGTGGWACRTCATCMGGTGATGC

145---------------------170

Bat coronavirus isolate B18-171 RNA-dependent RNA polymerase (RdRp) gene, partial cds. Sequence ID: MK991947.1 Length: 387

BBQ1

0.1

RdRP_SARSr-P2

FAM

CAGGTGGAACCTCATCAGGAGATGC

15470----------------15494

Specific for 2019-nCoV, will not detect SARSCoV.

Wuhan seafood market pneumonia virus isolate 2019-nCoV/USA-AZ1/2020, complete genome Sequence ID: MN997409.1Length: 29882

BBQ1

0.1

 

 

E gene

 

 

E_Sarbeco_F1

 

ACAGGTACGTTAATAGTTAATAGCGT

26269------------------26294

 

0.4

E_Sarbeco_R2

 

ATATTGCAGCAGTACGCACACA

26381---------------26360

 

0.4

E_Sarbeco_P1

FAM

ACACTAGCCATCCTTACTGCGCTTCG

26332------------------26357

Sequence ID: MN997409.1. Also detects MK211378.1, MK062184.1 etc.

BBQ

0.2

 

Name

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

Working Conc. [μM]

 

 

nCoV Envelope Gene

 

 

CoV-EFP

 

ACTTCTTTTTCTTGCTTTCGTGGT

26295 ----------------26318

 

20

CoV-ERP

 

GCAGCAGTACGCACACAATC

26376------------26357

 

20

CoV-EP

FAM

CTAGTTACACTAGCCATCCTTACTGC

26326----------------26351

BBQ1

5

 

 

ORF1b-nsp14

 

 

CoV-EFP

 

ACTTCTTTTTCTTGCTTTCGTGGT

26295 ----------------26318

 

0.6

CoV-ERP

 

GCAGCAGTACGCACACAATC

26376------------26357

 

0.8

CoV-EP

FAM

CTAGTTACACTAGCCATCCTTACTGC

26326----------------26351

BBQ1

0.1

 

 

N  Protein

 

 

CoV-EFP

 

TAATCAGACAAGGAACTGATTA

29145---------------29166

 

0.6

CoV-ERP

 

TAATCAGACAAGGAACTGATTA

29145---------------29166

 

0.8

CoV-EP

FAM

GCAAATTGTGCAATTTGCGG

29196--------------29177

BBQ1

0.1

 

 

Reference

https://www.who.int/docs/default-source/coronaviruse/peiris-protocol-16-1-20.pdf?sfvrsn=af1aac73_4 

Liu G, Li H, Zhao S, Lu R, Niu P, Tan W. Viral and Bacterial Etiology of Acute Febrile Respiratory Syndrome among Patients in Qinghai, China.Biomed Environ Sci. 2019 Jun;32(6):438-445. https://www.sciencedirect.com/science/article/pii/S0895398819301230

Huang et al. 2020: https://www.sciencedirect.com/science/article/pii/S0140673620301835

---...----