Live Chat Support Software
800.227.0627

Primers and probes for AIDS/HIV research

Specific DNA probes allow the detection and discrimination of specific nucleic acid target sequences. In the early years of probe development, DNA probe development utilized material from natural sources or cloning DNA. However, synthetic DNA hybridization probes are now more commonly used for diagnostics.

Extensive research showed that using specific oligonucleotides allows sensitive detection and distinguishing of various virus types, including Hepatitis B virus, HSV type 1 and HSV type 2 virus, HIV viruses, and coronaviruses such as SARS-CoV and SARS-CoV-2 in clinical isolates.


Also, specific modification of synthetic oligonucleotides enables the design and synthesis of non-radioactive in situ hybridization probes. Biotin-labeled probes are one example. Over three-fourths of men infected with human immunodeficiency virus (HIV) also have at least one herpes virus detected in their semen. In this case, the cytomegalovirus (CMV) is most prevalent. The presence of CMV is associated with higher T-cell immune activation and with HIV disease progression in treated and untreated individuals.


HIV is known to have a significant genetic variability; therefore, achieving accurate quantification by real-time PCR may require primers and probes specific for each viral variant. An HIV database is available to download sequences for particular variants. 

HIV Genome


Structural Model of the HIV Particle


All primer and probes can be biotinylated or labeled as needed, for example with fluorophores to create hybridization probes.

 Table 1: Primer and Probes for HIV-1 Diagnostics using RT-PCR

Primer

Sequence

 

Early Region

Cr1

TCTCTGGCTAACTAGGGAACCCACTGCTT

Cr2

TGACTAAAAGGGTCTGAGGGATCTCTAGTTACCAG

 

gag region

ts5’gag

CAAGCAGCCATGCAAATGTTAAAAGA

skcc

TACTAGTAGTTCCTGCTATGTCACTTCC

SK38

ATAATCCACCTATCCCAGTAGGAGAAAT

SK39

TTTGGTCCTTGTCTTATGTCCAGAATGC

 

pol region

mf209

AAAGCGTCTAGCCATGGCGTTAGTA

mf302

CAAATTTCTACTAATGCTTTTATTTTTTC

 

tat region

mf1

CTTAGGCATCTCCTATGGCAGGAA

mf238

GCTATTATTGCTGCTACTACTAATGCTACTA

 

sa7 region

mf222

GGCAGGGATATTCACCATTATCGTTTCAGA

mf83

GGATCTGTCTCTGTCTCTCTCTCCACC

 

nef region

mf345

AATCAGGGAAGTAGCCTTGTGT

mf346

GAGGTGGGTTTTCCAGT

Beacon 

5′-FAM-CGGGAGTACTCACCAGTCGCCGCCCCTCGCCCTCCCG-DABCYL-3′ 

HIV-1 (SK-19) Probe

ATCCTGGGATIAAATAAAATAGTAAGAATGTATAGCCCTAC

.

Reference

Althaus CF, Gianella S, Rieder P, et al. Rational design of HIV-1 fluorescent hydrolysis probes considering phylogenetic variation and probe performance. J Virol Methods. 2010;165:151–60. [Pdf]

Christopherson, C., Kidane, Y., Conway, B., Krowka, J., Sheppard, H., Kwok, S., 2000. PCR-Based assay to quantify human immunodeficiency virus type 1 DNA in peripheral blood mononuclear cells. J.Clin.Microbiol. 38, 630-634. [PMC]

Fischer, M., Joos, B., Hirschel, B., Bleiber, G., Weber, R., Günthard, H.F., 2004. Cellular viral rebound after cessation of potent antiretroviral therapy predicted by levels of multiply spliced HIV-1 RNA encoding nef. J Infect Dis 190, 1979-88. [Pdf]

HIV database

Kaiser, P., Joos, B., Niederoest, B., Weber, R., Günthard, H.F., Fischer, M., Study, T.S.H.C., 2007. Productive Human Immunodeficiency Virus 1 Infection in peripheral Blood Predominantely Takes Place in CD4/CD8 double negative T Lymphocytes. J Virol 81, 9693-9706. [PMC]

Lewin, S.R., Vesanen, M., Kostrikis, L., Hurley, A., Duran, M., Zhang, L., Ho, D.D., Markowitz, M., 1999. Use of Real-Time PCR and molecular beacons to detect virus replication in human immunodeficiency virus type 1-infected individuals on prolonged effective antiretroviral therapy. J.Virol. 73, 6099-6103. [PMC]

Musumeci D, Riccardi C, Montesarchio D. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents. Molecules. 2015 Sep 22;20(9):17511-32. [PMC]

---...---