Live Chat Support Software
800.227.0627

FISH Readout Probes for Colorimetric Detection of SNPs

Single nucleotide polymorphisms (SNPs) result from a single nucleotide mutation in the genome. Many SNPs are closely linked to human diseases and drug efficiency. Single-nucleotide variations (SNVs) are biomarkers allowing the detection of drug resistance in cancer and bacterial infection. Unfortunately, the nonspecific binding of DNA probes limits their specific detection.

In 2016, Chen et al. developed a universal low-cost assay for the colorimetric discrimination of drug-resistance-related point mutation. The assay utilizes a universal DNA probe and a split G-quadruplex allowing for recognition with the naked eye at room temperature. Using the DNA probe as a signal reporter improves the universality and enables a high specificity during probe hybridization.

Chen et al. applied the assay for the detection of cancer-related SNVs in the following genes: the epidermal growth factor receptor (EGFR) gene, Kirsten rat sarcoma viral oncogene homolog (KRAS), and tuberculosis drug-resistance related point mutations in the RNA polymerase beta subunit gene (rpoB).

The researchers suggested that this method is simple, rapid, effective, and enables high-throughput detection suitable for point-of-care applications.

A similar method called
 MERFISH  enables multiplexed fluorescence in situ hybridization.

Table 1: Signal report strand for colorimetric detection.

 

A

 GTTAAATCGTGGATAGTAGACGCACATGGGT

B

 TGGGTAGGGCGGGTGTGCCAGGTACATTTGCTCGTCCTT

 

Table 2: Signal report strand for fluorescence detection.

 

A

 BHQ1-GTGCGAACAGGTACATTTGCTCGTCCTT

B

 GTTAAATCGTGGATAGTAGACTTCGCAC-FAM'6

 

Table 3: Sequences of different signal probe for optimization of G-quadruplex split modes.

 

1:1

A

 CCAAGGTGGTGTGTGTATAGTGAGGGCAGGG

B

 GGGAGGTGCTCACTATACACACACCACCAACC

1:3+s

A

 CCAAGGTGGTGTGTGTATAGTGATGGGTAGGGCGGG

B

 AGTCAGTCAGTCACTCACTATACACACACCACCAACC

S

 TGGGTGACTGACTGACT

1:3

A

 CCAAGGTGGTGTGTGTATAGTGAATGGGT

 

B

 TGGGTAGGGCGGGTCTCACTATACACACACCACCAACC

 

Table 4: Sequences for the optimization of the number of complement bases between A and B.

 

5’- TCG CAC

A

 GTTAAATCGTGGATAGTAGACTCGCACATGGGT

B

 TGGGTAGGGCGGGTGTGCGACAGGTACATTTGCTCGTCCTT

5’- CG CAC

A

 GTTAAATCGTGGATAGTAGACCGCACATGGGT

B

 TGGGTAGGGCGGGTGTGCGCAGGTACATTTGCTCGTCCTT

5’- G CAC

A

 GTTAAATCGTGGATAGTAGACGCACATGGGT

B

 TGGGTAGGGCGGGTGTGCCAGGTACATTTGCTCGTCCTT

5’- CAC

A

 GTTAAATCGTGGATAGTAGACCACATGGGT

B

 TGGGTAGGGCGGGTGTGCAGGTACATTTGCTCGTCCTT

5’- AC

A

 GTTAAATCGTGGATAGTAGACACATGGGT

B

 TGGGTAGGGCGGGTGTCAGGTACATTTGCTCGTCCTT

 

 

 

 

 

 

 

 

 

 

 

 

Table 5: Sequences of SNV, WT, and target-specific X-probe components for EGFR mutations.

 

EGFR-G719A

SNV

 TTCAAAAAGATCAAAGTGCTGGCCTCCGGT

WT

 TTCAAAAAGATCAAAGTGCTGGGCTCCGGT

P

 AAGGACGAGCAAATGTACCTGCACAAAAAGATCAAAGTGCTGG

C

 CGGAGGCCAGCACTTTGATCTTTTTGTGGTCTACTATCCACGATTTAAC

EGFR-S768I

SNV

 GCCTACGTGATGGCCATCGTGGACAACCCC

WT

 GCCTACGTGATGGCCAGCGTGGACAACCCC

P

 AAGGACGAGCAAATGTACCTGCACTACGTGATGGCCATCGT

C

 GGTTGTCCACGATGGCCATCACGTAGTGGTCTACTATCCACGATTTAAC

EGFR-T790M

SNV

 GTGCAGCTCATCATGCAGCTCATGCCCTTC

WT

 GTGCAGCTCATCACGCAGCTCATGCCCTTC

P

 AAGGACGAGCAAATGTACCTGCAGCAGCTCATCATGCAGCTC

C

 AGGGCATGAGCTGCATGATGAGCTGCTGGTCTACTATCCACGATTTAAC

EGFR-L858R

SNV

 ATGTCAAGATCACAGATTTTGGGCGGGCCA

WT

 ATGTCAAGATCACAGATTTTGGGCTGGCCA

P

 AAGGACGAGCAAATGTACCTGCAGTCAAGATCACAGATTTTGG

C

 GCCCGCCCAAAATCTGTGATCTTGACTGGTCTACTATCCACGATTTAAC

EGFR-L861Q

SNV

 TGGCCAAACAGCTGGGTGCGGAAGAGAAAG

WT

 TGGCCAAACTGCTGGGTGCGGAAGAGAAAG

P

 AAGGACGAGCAAATGTACCTG CAGCCAAACAGCTGGGTGCG

C

 TTTCTCTTCCGCACCCAGCTGTTTGGCTG GTCTACTATCCACGATTTAAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 



Table 6: Sequences of SNV, WT, and target-specific X-probe components for KARAS mutations.

 

KRAS-G12A

SNV

 CTTGTGGTAGTTGGAGCTGCTGGC

WT

 CTTGTGGTAGTTGGAGCTGGTGGC

P

 AAGGACGAGCAAATGTACCTGCAACTTGTGGTAGTTGGAG

C

 GCCAGCAGCTCCAACTACCACAAGTTGGTCTACTATCCACGATTTAAC

KARAS-G12R

SNV

 CTTGTGGTAGTTGGAGCTCGTGGC

WT

 CTTGTGGTAGTTGGAGCTGGTGGC

P

 AAGGACGAGCAAATGTACCTGCAACTTGTGGTAGTTGGAGC

C

 GCCACGAGCTCCAACTACCACAAGTTGGTCTACTATCCACGATTTAAC

KARAS-G13D

SNV

 CTTGTGGTAGTTGGAGCTGGTGACGTAGGC

WT

 CTTGTGGTAGTTGGAGCTGGTGGCGTAGGC

P

 AAGGACGAGCAAATGTACCTGCATGTGGTAGTTGGAGCTGG

C

 CTACGTCACCAGCTCCAACTACCACATGGTCTACTATCCACGATTTAAC

KARAS-G13V

SNV

 CTTGTGGTAGTTGGAGCTGGTGTCGTAGGC

WT

 CTTGTGGTAGTTGGAGCTGGTGGCGTAGGC

P

 AAGGACGAGCAAATGTACCTG CATGTGGTAGTTGGAGCTGG

C

 CTACGACACCAGCTCCAACTACCACATGGTCTACTATCCACGATTTAAC

KARAS-Q61H

SNV

 GCAGGTCACGAGGAGTACAGTGCAATGAGG

WT

 GCAGGTCAAGAGGAGTACAGTGCAATGAGG

P

 AAGGACGAGCAAATGTACCTG CAAGGTCACGAGGAGTACAG

C

 TCATTGCACTGTACTCCTCGTGACCTTG GTCTACTATCCACGATTTAAC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 



Table 7: Sequences of SNV, WT, and target-specific X-probe components for EGFR mutations.

 

rpoB-531

SNV

 ACCCACAAGCGCCGACTGTTG

WT

 ACCCACAAGCGCCGACTGTCG

P

 AAGGACGAGCAAATGTACCTGCA ACCCACAAGCGCCGA

C

 CAACAGTCGGCGCTTGTGGGTTGGTCTACTATCCACGATTTAAC

 

 

 

 

 

 

Table 8: Sequences for the mismatched detection.

 

rpoB-531

Target DNA

 ACCCACAAGCGCCGACTGTTG

Single-base mismatch DNA

 ACCCACAAGCGCCGACTGTCG

Three-base mismatch DNA

 ACCCACAAGCGCCGACTCACG

Non-complementary DNA

 TAGTGGTCTCATGTCCACGTA

EGFR-T790M

Target DNA

 GTGCAGCTCATCATGCAGCTCATGCCCTTC

Single-base mismatch DNA

 GTGCAGCTCATCACGCAGCTCATGCCCTTC

Three-base mismatch DNA

 GTGCAGCTCATCTCACAGCTCATGCCCTTC

Non-complementary DNA

 TACTGATGACCAGTCGACGAACATGATCGT

KARAS-G12R

Target DNA

 CTTGTGGTAGTTGGAGCTCGTGGC

Single-base mismatch DNA

 CTTGTGGTAGTTGGAGCTGGTGGC

Three-base mismatch DNA

 CTTGTGGTAGTTGGAGCAGCTGGC

Non-complementary DNA

 TACTGATGTCCACTCTAGGAACTA

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

.


Reference

Chen X, Zhou D, Shen H, Chen H, Feng W, Xie G. A universal probe design for colorimetric detection of single-nucleotide variation with visible readout and high specificity. Sci Rep. 2016 Feb 2;6:20257. [ PMC ]

Read out probes for MERFISH 


---...---