Live Chat Support Software
800.227.0627

PCR Primers for Hepatitis B Virus (HBV) Detection

The Hepatitis B virus (HBV) causes liver infection, but for some people, it is just an acute or short-term infection, however, for others, it can become a long-term, chronic infection called chronic hepatitis.


Chronic Hepatitis B can lead to serious health issues. Vaccination against HBV is the best way to prevent infections with HBV. However, infections with HBV remain a top health problem worldwide. In 2013 alone, HBV infections caused approximately 600,000 deaths. According to Papastergiou et al., more than 350 million people are chronically infected with HBV.

Detection and measurements of HBV DNA levels are now routinely used for the identification of infectious, chronic carriers and the prediction and monitoring of efficacies of antiviral treatment.


Real-time PCR (RT PCR) is now widely accepted as the gold standard for quantification of viral nucleic acids. RT PCR allows quantification of HBV DNA with improved speed of detection, high sensitivity, and reproducibility, as well as a low risk of contamination. Several real-time PCR assays have been developed usually using two pairs of primers and probes often based on the conserved S and C regions of the HBV genome.

Primers used for the amplification of HBV complete genomes 
 

Primera

Sequence (5′–3′)

Position (nt)b

Amplicon (bp)

Sequencing primer

PR1a

(Ta = 4°C)

     

251F

GACTYGTGGTGGACTTCTC

251–269

940

Yes

1190R

TCAGCAAAYACTYGGCA

1190–1174

 

Yes

PR1b

(Ta = 54°C)

     

595F

CACHTGTATTCCCATCCCA

595–613

1,203

Yes

1797R

CCAATTTMTGCYTACAGCCTC

1797–1777

 

No

1190F

AYGCAACCCCCACTGG

1190–1205

 

Yes

PR 2a

(Ta = 50°C)

     

2300F

CCACMWAATGCCCCTATC

2300–2317

1,131

Yes

215R

AGRAAMACMCCGCCTGT

215–200

 

Yes

PR 2b

(Ta = 50°C)

     

2819F

ACCWTATWCYTGGGAACAA

2819–2837

1,032

Yes

617Rc

GAYGAYGGGATGGGAATACA

617–598

 

Yes

654R

GSCCCAMBCCCATAGG

652–637

 

No

PR 3

(Ta = 52°C)

     

1859F

ACTNTTCAAGCCTCCRAGCTG

1859–1879

959

No

1877F

CTGTGCCTTGGRTGGCTT

1894–1877

 

Yes

2835R

GTTCCCAVGWATAWGGTGAYCC

2835–2814

 

Yes

PR 4

(Ta = 57°C)

     

1584F

ACTTCGMBTCACCTCTGCACGT

1583–1604

748

No

2331R

GGAAGYGTKGAYARGATAGGGGCATT

2331–2306

 

Yes

2396R

GTCKGCGAGGYGAGGGAGTT

2396–2377

 

No



aSuffix “F” indicates forward primer, whereas suffix “R” indicates reverse primer.

bWith reference to NC_003977. https://www.ncbi.nlm.nih.gov/nuccore/NC_003977 Hepatitis B virus (strain ayw) genome

cAn annealing temperature of 54°C was used during sequencing cycling to ensure a high rate of success of sequencing.


BNA Primers and Probes


Artificial nucleic acids such as bridged nucleic acids (BNAs) can also be incorporated into oligonucleotide probes to increase sensitivity and selectivity of the probes.

 

Primer

Probes

Sequence

Bases

Tm (°C)

 

 

 

 

P1

GACCACCAAATGCCCCTAT

19

55

P2

CCRAGAYYGAGATCTTCTGCGAC

23

53

BNA probe

FAM-TCGTCTAACAACAGT-BHQ1

 

 

TaqMan

FAM-TCGTCTAACAACAGT(TAMMRA)AGTTTCCGGAAGTGT-P

 

 

 

aThe underlined nucleotides indicate a BNA monomer substitution. Tm, temperature; BNA, bridged nucleic acid (e.g. BNA or LNA) ; HBV, hepatitis B virus; PCR, polymerase chain reaction. (Source: Wang et al. 2011.)  https://www.cdc.gov/hepatitis/hbv/index.htm

 

More primers and probe sequences for the S and C regions.

 

Primer and Probe

Sequence (5′-3′)

S-F

GATGTGTCTGCGGCGTTTTA

S-R

GCAACATACCTTGATAGTCCAGAAGAA

S-P

Vic-CCTCTICATCCTGCTGCTATGCCTCA-BHQ1

C-F

TTCCGGAAACTACTGTTGTTAGAC

C-R

ATTGAGATTCCCGAGATTGAGA

C-P

Fam-CCCTAGAAGAAGAACTCCCTCGCCTC-BHQ1

Sa-F

TCGTGTTACAGGCGGGGTTT

Sa-R

GGCACTAGTAAACTGAGCCA

Ca-F

CCTACTGTTCAAGCCTCCAA

Ca-R

AATGTCCTCCTGTAAATGAATGT

 

 

Reference

Chao Liu, Le Chang, Tingting Jia, Fei Guo, Lu Zhang, Huimin Ji, Junpeng Zhao and Lunan Wang; Real-time PCR assays for hepatitis B virus DNA quantification may require two different targets.Virology Journal201714:94. https://doi.org/10.1186/s12985-017-0759-8.

Chook, J. B., Teo, W. L., Ngeow, Y. F., Tee, K. K., Ng, K. P., & Mohamed, R. (2015). Universal Primers for Detection and Sequencing of Hepatitis B Virus Genomes across Genotypes A to G. Journal of clinical microbiology, 53(6), 1831-5. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4432068/

Hepatitis B Info:

https://health.mil/Military-Health-Topics/Health-Readiness/Immunization-Healthcare/Vaccine-Preventable-Diseases/Hepatitis-B
http://www.medsci.org/v08p0321.htm
https://virologyj.biomedcentral.com/articles/10.1186/s12985-017-0759-8

Papastergiou, V., Lombardi, R., MacDonald, D. et al. Global Epidemiology of Hepatitis B Virus (HBV) Infection. Curr Hepatology Rep (2015) 14: 171. https://doi.org/10.1007/s11901-015-0269-3. https://link.springer.com/article/10.1007%2Fs11901-015-0269-3

Wang, Q., Wang, X., Zhang, J., & Song, G. (2011). LNA real-time PCR probe quantification of hepatitis B virus DNA. Experimental and therapeutic medicine, 3(3), 503-508. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3438541/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3729363/
---...---