Header

Header

Header

siRNAs or interference RNA for COVID-19

siRNAs or interference RNA for COVID-19

RNA interference as a technology allows knocking down genes after transcription. RNA interference can potentially allow selective knocking down or silencing of targeted SARS-CoV-2 (COVID-19) genes. Packaging RNA interference drugs for COVID-19 using synthetic RNA as nasal sprays may offer an effective way to treat COVID-19 patients. Also, carrier molecules are known to increase half-lives, chemical stability, and prevent degradation of RNA by nucleases useful for the delivery of RNA into cells. However, for efficient gene-silencing, it is essential to select the correct double-stranded RNA molecules.

Small interfering RNA (siRNA), also known as short interfering RNA or silencing RNA, is known to regulate gene expression. This type of regulation is also known as RNA interference (RNAi).

Andrew Z. Fire and Craig C. Mello received the Nobel Prize for Physiology or Medicine in 2006 for their discovery of RNA interference – gene silencing by double-stranded RNA.  Fire and Mello found that double-stranded RNA can silence genes. The two scientists showed that RNAi is specific for the gene whose code matches the injected RNA molecule.


Figure 1: RNAi, the process in which small RNA molecules activate the cellular response to destroy specific RNA molecules such as mRNAs (Source: Wiki Commons).

siRNAs are a class of double-stranded non-coding RNA molecules, usually 20 to 25 base pairs in length. siRNA based therapeutics have already been developed and implemented as anticancer and antiviral drugs, including drugs for the treatment of genetic diseases.

The outbreak of the novel coronavirus Severe Acute Respiratory Syndrome 2 (SARS-CoV-2 – COVID-19) pandemic in December 2019, started the testing of many drugs for the treatment of the disease. Candidates for testing are the antiviral drugs remdesivir, favipiravir, lopinavir, ritonavir, and arbidol.  Other candidates for clinal trials are the antimalarial drug hydroxychloroquine, and anticancer agents interferon-alpha 2b.  However, the efficacy of these drugs against SARS-CoV-2 has yet to be proven.

In that light, siRNA based treatments may also provide a therapeutic solution. A few studies have already demonstrated that selected siRNA candidates have the potential to be effective against the outbreak of SARS and Middle-East Respiratory Syndrome (MERS). Several siRNA-related patents already were issued: CN1548054, WO2005019410, CN101173275, CN101113158, CN1010085986, and US865352.

Earlier studies showed that siRNAs targeting sequences coding for several viral genes of various SARS viruses decreased the viral load between 50 to 95 %. siRNAs targeting the N protein gene appeared to work the best. Zhang et al., in 2004, demonstrated that the expression of SARS-CoV spike protein is silenced in cultured cells using RNA interference. For expression the spike protein in cultured cells, the research group used an expression vector with a cytomegalovirus (CMV) promoter.  Tagging the spike protein with hemagglutinin allowed the monitoring of its expression. Vero E6 cells were used for the propagation of the SARS-CoV strain investigated. A vector containing a U6 promotor enabled the construction of a 22 base pair hairpin siRNAs using the sequence UUCAAGAGA for the hairpin loop.

Figure 2:  Diagram of predicted structure of siRNAs used by Zhang et al. in 2004.

The following year Li et al. reported the design of siRNAs targeting the leader sequence of SARS-CoV to inhibit virus replication. The results showed that siRNAs inhibit the replication of the SARS-CoV virus in infected Vero E6 cells. The scientists identified a putative 5′ leader sequence similar to the conserved coronavirus core leader sequence, 5′-CUAAAC-3′, at the 5′-end of the genome. Furthermore, manual alignment of sequences upstream of potential methionine codons with the leader sequence region allowed the identification of the putative conserved transcription-regulating sequence (TRS), AAACGAAAC.

Next, the research group cloned the transcripts of the four genes from SARS-CoV BJ01 and confirmed the SARS-CoV Leader sequence as CCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATCTGTTCTCTAAACGAAC.

This sequence is present in the SARS CoV HKU-39849 genome. Li et al. showed that a siRNA targeting the leader sequence of SARS-CoV inhibited gene expression and replication of the virus in cultured cells. siRNAs can also be chemically synthesized and modified such that they can enter cells with high efficiency allowing optimal delivery into cells. For example, modifying synthetic oligonucleotides with lipophilic groups allows for efficient uptake of siRNAs by cells.


Figure 2: Sequence information for siRNA design for SARS-CoV. The leader sequence as reported by Li et al.  is underlined and highlighted in turquoise. The sequence region used for an siRNA is highlighted in green. The sequence UUCAAGAGA was used for the hairpin loop. In a similar fashion, siRNAs can be designed for silencing the leader sequence of SARS-CoV-2 (COVID-19).

Figure 3: Example of siRNA design for SARS-CoV-2.

In summary, Li et al. demonstrated that siRNAs significantly inhibit Spike protein expression in transfected cells as well as in SARS-CoV infected cells. The observed inhibition of S gene mRNA accumulation suggests that siRNAs may inhibit SARS‐CoV replication in cells. Therefore completely knocking out or silencing one of the viral genes should block replication of the virus. However, since one siRNA will only knock down the expression of the targeted gene, several siRNAs may be needed for complete inhibition of viral replication.

Tang et al., in 2008, studied the effect of siRNA duplexes as SARS CoV inhibitors in vitro and evaluated in vivo efficacy and safety in a rhesus macaque SARS model. Delivery of siRNAs occurred using intranasal administration with a clinically viable delivery carrier in three dosing regimens. The use of microscopy allowed the inspection of SARS CoV-induced SARS-like symptoms in the animal's respiratory tract and lungs.Viral RNA testing and immunohistochemistry sections from 21 tested macaques consistently demonstrated siRNA-mediated anti-SARS CoV activity. This study illustrated that siRNA enables a reduction in development time for novel siRNA based targeted therapeutic agents.

Sutou et al., in 2009, reported the design of siRNAs for knocking down SARS-CoV genes. The researchers used siRNA-expression vectors and synthetic double-stranded RNA (dsRNA) as a model for siRNA Design. The study found that 19-mer to 21-mer dsRNAs with a matched 2-nt overhang at the 3'- end of the antisense strand exhibited the highest activity. Since the thermodynamic stability of siRNAs at terminal ends had little effect the 2-nt overhang appears to be more critical than thermodynamic stability for the selection of the antisense strand to the RNA-induced silencing complex (RISC).

Nur et al., in 2015, used computational methods for the identification and design of siRNAs predicted to silence MERS-CoV genes. The study designed four miRNAs and five siRNAs for silencing nine different MERS-CoV strains. The use of ORF1ab sequences allowed the prediction of siRNA and miRNA molecules.

Reference

Cell uptake of siRNAs

Li T, Zhang Y, Fu L, Yu C, Li X, Li Y, Zhang X, Rong Z, Wang Y, Ning H, Liang R, Chen W, Babiuk LA, Chang Z. siRNA targeting the leader sequence of SARS-CoV inhibits virus replication. Gene Ther. 2005 May;12(9):751-61. [
PMC]

Nur SM, Hasan MA, Amin MA, Hossain M, Sharmin T. Design of Potential RNAi (miRNA and siRNA) Molecules for Middle East Respiratory Syndrome Coronavirus (MERS-CoV) Gene Silencing by Computational Method. Interdiscip Sci. 2015 Sep;7(3):257-65. [
PMC]

Remdesivir

RNA delivery using nanocarriers

Shizuyo Sutou, Miho Kunishi, Toshiyuki Kudo, Kenji Kawano, Yasuomi Takagi, Malgorzata Sierant, Masayuki Sano, Makoto Miyagishi; Knockdown of Severe Acute Respiratory Syndrome Corona Virus (SARS-CoV) Genes by Small Interfering RNA (siRNA) Using siRNA-expression Vectors and Synthetic Double-stranded RNA (dsRNA) as a Model for siRNA Design. Genes and Environment, 2009, Volume 31, Issue 1, Pages 15-23. [
Article]

Tang Q, Li B, Woodle M, Lu PY. Application of siRNA against SARS in the rhesus macaque model. Methods Mol Biol. 2008;442:139-58. [
PMC]

Zhang Y, et al. Silencing SARS-CoV spike protein expression in cultured cells by RNA interference. FEBS Lett. 2004;560:141–146. doi: 10.1016/S0014-5793(04)00087-0. [
PMC] [PubMed]


---...---

Why Choose Bio-Synthesis

Trusted by biotech leaders worldwide for over 45+ years of delivering high quality, fast and scalable synthetic biology solutions.