Live Chat Support Software
800.227.0627

Fluorogenic oligonucleotide probes for allelic discrimination of coronaviruses

Sequence analysis of SARS-coronavirus isolates performed by Chung et al. in 2005 revealed that specific genotypes predominated at different periods of the SARS 2002-2003 epidemic. The availability of genomic sequence information allows tracing the footprint of viral infections as well as monitoring viral evolution. However, direct sequencing analysis of large numbers of clinical samples is cumbersome and time-consuming. Hence in 2005, Chung et al. developed and reported a simple and rapid assay for the screening of SARS-coronavirus genotypes based on the use of fluorogenic oligonucleotide probes for allelic discrimination.

The fact that the genomic sequence of the causative agent, SARS-CoV, was characterized in 2003 allowed the development of primer and probes sets, including synthetic standards. Early studies focusing on the detection and diagnosis of SARS-CoV demonstrated that specific viral genotypes predominated at certain periods during the outbreak. The availability of sequence data on SARS-CoV made it possible to subclassify viral isolates into several major genotypes based on nucleotide variations.

Pavlović-Lažetić et al. in 2005 grouped viral genome polymorphism into two groups, one with a small number of SNVs and another with a large number of SNVs, including up to four subgroups concerning insertions and deletions. During a bioinformatic study, three nine-locus genotypes: TTTT/TTCGG, CGCC/TTCAT, and TGCC/TTCGT, with four subgenotypes, were found as well. Chung et al. used this information for the design of primer, probe, and synthetic standard sets.

Correctly selected and designed primer and probe sets enable accurate characterization and screening of SARS-coronavirus genotypes. The use of these tools allows studying epidemiological relationships as well between documented cases during an outbreak.

Table 1: Primers and probes

SNV 17564*

 Sequence

Forward primer

GACACTGTGAGTGCTTTAGTTTATGACA

Reverse primer

CCTTTGTAGAACATTTTGAAGCATTG

Probes

FAM-AGCTGACTTATCCTTGTGT

 

VIC-AGCTGACTTCTCCTTGTGT

Synthetic template for allele T

GTTGACACTGTGAGTGCTTTAGTTTATGACAATAAGCTAAAAGCACACAAGGATAAGTCA

GCTCAATGCTTCAAAATGTTCTACAAAGGTGT

Synthetic template for allele G

GTTGACACTGTGAGTGCTTTAGTTTATGACAATAAGCTAAAAGCACACAAGGAGAAGTCA

GCTCAATGCTTCAAAATGTTCTACAAAGGTGT

SNV 21721

 

Forward primer

CCATTTTATTCTAATGTTACAGGGTTTCA

Reverse primer

TTTCTCTGTGGCAGCAAAATAAATAC

Probes

FAM-ATACGTTTGGCAACCCTGTC

 

VIC-ATACGTTTGACAACCCTGTC

Synthetic template for allele G

CTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGGCAACCCT GTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCA

Synthetic template for allele A

CTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGACAACCCT GTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCA

SNV 22222

 

Forward primer

GAGCCATTCTTACAGCCTTTTTA

Reverse primer

GCCAACAAAATAGGCTGCAG

Probes

FAM-TGCTCAAGACACTTGGG-MGB

 

VIC-TGCTCAAGACATTTGGG-MGB

Synthetic template for allele C

GCCATTCTTACAGCCTTTTTACCTGCTCAAGACACTTGGGGCACGTCAGCTGCAGCCTAT TTTGTTGGCTATTTAAAGCCAACTACATTTATGCTCAAGTATGATG

Synthetic template for allele T

GCCATTCTTACAGCCTTTTTACCTGCTCAAGACATTTGGGGCACGTCAGCTGCAGCCTAT TTTGTTGGCTATTTAAAGCCAACTACATTTATGCTCAAGTATGATG

SNV 23823

 

Forward primer

TCGCTCAAGTCAAACAAATGTACA

Reverse primer

GAGGGTCAGGTAATATTTGTGAAAAATT

Probes

FAM-CCAACTTTGAAATATTTTGG

 

VIC-CAACTTTGAAAGATTTTGG

Synthetic template for allele T

TGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTA

ATTTTTCACAAATATTACCTGACCCTCTAA

Synthetic template for allele G

TGTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAAGATTTTGGTGGTTTTA

ATTTTTCACAAATATTACCTGACCCTCTAA

SNV 27827

 

Forward primer

TCATTGTTTTGACTTGTATTTCTCTATGC

Reverse primer

CTTCAAGCACATGAGGTTTATTAGATG

Probes

FAM-TTGCATATGCACTGTAGT

 

VIC-TTGCATACGCACTGTAGT

Synthetic template for allele C

TTCTCATTGTTTTGACTTGTATTTCTCTATGCAGTTGCATATGCACTGTAGTACAGCGCT

GTGCATCTAATAAACCTCATGTGCTTGAAGATCC

Synthetic template for allele T

TTCTCATTGTTTTGACTTGTATTTCTCTATGCAGTTGCATACGCACTGTAGTACAGCGCT

GTGCATCTAATAAACCTCATGTGCTTGAAGATCC


* probes for SNV 17564 are anti-sense sequences.

Recently the number of genomic sequences for SARS-CoV-2 has increased tremendously.  Utilizing this information now allows the design of primer, probe, and standard sets for the discrimination of SARS-CoV-2 strains similar to the ones listed in Table 1.

Adding bridged nucleic acids (BNAs) at selected positions within the oligonucleotide sequence of a probe allows designing primers and probes with enhanced sensitivity, increased base stacking, binding affinity, aqueous solubility, and nuclease resistance. Oligonucleotides modified with BNAs, for example, qPCR probe, exhibit improved duplex and triplex formation by reducing the repulsion between the negatively charged phosphates of the oligonucleotide backbone. BNA based probes are especially useful for diagnostic tools such as FISH probes and others. Also, BNA oligonucleotides are less toxic than other modified nucleotides for clinical application.

Reference

Gordana M.Pavlović-Lažetić, Nenad S.Mitić, Andrija M.Tomović, Mirjana D.Pavlović, Miloš V.Beljanski;SARS-CoV Genome Polymorphism: A Bioinformatics Study. Genomics, Proteomics & Bioinformatics, Volume 3, Issue 1, 2005, Pages 18-35. [PMC]

Chung, G.T., Chiu, R.W., Cheung, J.L. et al. A simple and rapid approach for screening of SARS-coronavirus genotypes: an evaluation study. BMC Infect Dis 5, 87 (2005). [
Link
]

Bio-Synthesis Inc. is pleased to offer a large variety of oligonucleotides and peptides for a number of research applications, including COVID 19 testing, analysis and vaccine development!

 

---...---