Live Chat Support Software
800.227.0627

Primers for Respiratory Virus Diagnostics

Several viruses can infect the lower and upper respiratory tract of us humans. The respiratory system allows us to breathe. The respiratory system includes several organs and structures needed to exchange gases such as oxygen (in) and carbon dioxide (out). Parts of the respiratory system are the nose and nasal cavity, the sinuses, mouth, throat, voice box, windpipe, diaphragm, and the lungs. Many common viral infections target the upper respiratory system causing severe symptoms in infants, the elderly, and patients with lung or heart problems.

The list of common respiratory viruses includes the epidemic influenza viruses A, B, C, avian influenza viruses, parainfluenza viruses 1–4, adenoviruses, coronaviruses, orthohantaviruses, and respiratory syncytial virus and human metapneumovirus, as well as rhinoviruses.

Symptoms of different respiratory infections, also known as clinical presentation, caused by various viral pathogens, can be very similar. Hence, the correct diagnosis is quite tricky. A rapid virological method will allow a specific and sensitive diagnosis at an early stage of the infection. Significant advances in modern molecular technics have enabled the speedy and sensitive detection of viral pathogens. Polymerase chain reaction (PCR) based methods are now considered as the gold standard of viral assays. For many RNA viruses, including respiratory viruses, multiplex reverse transcription (RT)-PCR assay-based diagnosis allows rapid, sensitive, and specific detection.


PCR primers and probes for respiratory syncytial viruses A and B and parainfluenzavirus 3, causing bronchiolitis in children.

Eugene-Ruellan et al., in 1998, developed a reverse-transcription-PCR and hybridization-enzyme immunoassay (RT-PCR-EIA) for the detection and identification of significant bronchiolitis agents in infants. Bronchiolitis is a common lung infection in young children and infants. Bronchiolitis refers to inflammation and congestion in the small airways, also known as bronchioles of the lung. In children and infants, the respiratory syncytial viruses A and B (RSVA and RSVB) and parainfluenzavirus 3 (PIV3) cause bronchiolitis of the lower respiratory tract.

For virus diagnosis, the research group designed two primer sets (P1-P2 and P1-P3) using sequences in the polymerase L gene's conserved region. This molecular method allows detection in a single step and paramyxoviruses RSVA, RSVB, and PIV3 typing. Please review the alignment of the functional motifs A and C in the viral L gene in Eugene-Ruellan et al.


Table 1:
PCR primers and probes for respiratory syncytial viruses A and B and parainfluenzavirus 3.


Virus(es)

Target gene


Forward primer(s)

(5’–3’)


Reverse primer(s)

(5’–3’)


Probe(s)

RSVA,

 PIV3,

 Sendai,

PIV2,

MEAS,

MUMP,

SV5,

NDV

Functional motifs A and C of the L polymerase gene 

 P1:

 ACAACAGATCTCAGCAAAT

 P2:

 CTATTGCTTGATTGTCACC 

 

 P3: 

 CTATTGCTTGATTGTCTCC

 RSVA probe

     5′-2289---------------------------2250-3′
 
TACATTGTTAGGATCTACAGTATGATCTCCTATATAGGGG


   RSVB probe:

  5′-------------------------------2250-3′
  AACTTCATTAAGATTGACAACATGATCCTTTATGAAAGGA


   PIV3 probe:

  5′-2095-------------------------2056-3′
 
GAGGGTGTAACCAATTAAACAATTTATTTAATCCAAATA

 

 

 

 

  Note: Probes are biotinylated at the 5’-end.


Primers for influenza viruses, parainfluenza viruses, adenoviruses, coronaviruses, orthohantaviruses, respiratory syncytial virus and human metapneumovirus, and rhinoviruses.


Coiras et al., in 2004, developed a multiplex RT-nested PCR assay for the detection and identification of several respiratory viruses.These include the human parainfluenza viruses types 1, 2, 3, and 4AB, the coronaviruses type 229E and OC43, and generic human enteroviruses and rhinoviruses. The researchers designed primers selecting sequences from the conserved regions of haemagglutinin genes, the conserved regions of coronavirus spike protein genes, and the polyprotein gene of rhinoviruses and enteroviruses, between the 5’-non-coding region (5’-NCR) and VP4/VP2 regions. Table 1 lists GenBank accession numbers of the viral sequences,  sequences, and properties of all primers studied.


Table 2: Primers for Respiratory Viruses including Human Parainfluenza Viruses (Parainf.), Coronaviruses, Enteroviruses (Enterov.), and Rhinoviruses (Rhinov.) Used in the First Round Multiplex RT-PCR and in the Following Nested PCR (Adapted from Coiras et al., 2004).

Amplification steps and primera

Sequence (5’-3’)

Gene

Gene position

Melting temp (°C)

G + C content (%)

Amplicon size (bp)

RT-PCRa

 

 

 

 

 

 

1-PIV13

AGGWTGYSMRGATATAGGRAARTCATA

HA

Parainf.1 (641-667)

Parainf.3 (635-661)

52–60

30–48

Parainf.1 (635)

Parainf.3 (635)

2-PIV13

CTWGTATATATRTAGATCTTKTTRCCTAGT

HA

Parainf.1 (1277-1248) Parainf.3 (1270-1241)

52–56

23–33

 

1-PIV2

TAATTCCTCTTAAAATTGACAGTATCGA

HA

Parainf.2 (259-286)

53

29

Parainf.2 (683) Parainf.4AB (1070)

1-PIV4

ATCCAGARRGACGTCACATCAACTCAT

5’NCR-HA

Parainf.4 (107-81)c

57–60

41–48

 

2-PIV24

TRAGRCCMCCATAYAMRGGAAATA

HA

Parainf.2 (942-919)

Parainf.4

(963-940)

49–59

29–54

 

1-HcoV

TGTGCCATAGARGAYWTACTTTTT

SP

229E

 (2068-2090)

 OC43 (2727-2750)

49–52

29–38

229E (851)

 OC43 (806)

2-HcoV

AACCGCTTKYACCAKCAAYGCACA

SP

229E (2919-2896)

OC43 (3533-3511)

54–61

42–58

 

1-EV/RV

CTCCGGCCCCTGAATRYGGCTAA

5’NCR-VP4/VP2

Enterov. 445-467d

59–62

57–65

Enterov. (755)

Rhinov.

(639)

2-EV/RV

TCIGGIARYTTCCASYACCAICC

5’NCR-VP4/VP2

Rhinov.1200-1178

53–64

43–68

 

Nestedb

 

 

 

 

 

 

3-PIV13

ACGACAAYAGGAARTCATGYTCT

HA

Parainf.1 (754-776)

Parainf.3 (748-770)

50–55

35–48

Parainf.1 (439)

Parainf.3

(390)

4-PIV1

GACAACAATCTTTGGCCTATCAGATA

HA

Parainf.1 (1193-1168)

55

38

 

4-PIV3

GAGTTGACCATCCTYCTRTCTGAAAAC

HA

Parainf.3 (1138-1112)

57–60

41–48

 

3-PIV24

CYMAYGGRTGYAYTMGAATWCCATCATT

HA

Parainf.2 (487-514)

Parainf.4 (509-536)

53–63

29–54

Parainf.2 (297)

Parainf.4AB (174)

4-PIV2

GCTAGATCAGTTGTGGCATAATCT

HA

Parainf.2 784-761

54

42

 

4-PIV4

TGACTATRCTCGACYTTRAAATAAGG

HA

Parainf.4 683-358

52–56

31–42

 

3-HcoV

TTGTGCGCAATGTTATAAWGGYAT

SP

229E (2174–2197)

OC43 (2831-2854)

51–52

33–38

229E (630)

OC43 (587)

4-HcoV

GATAATRTGAGTRCCATTWCCACA

SP

229E (2804–2781)

OC43 (3418–3696)

51–54

32–42

 

3-EV/RV

ACCRASTACTTTGGGTRWCCGTG

5’NCR-VP4/VP2

Enterov. 536–559c

55–59

48–57

Enterov. (226)

Rhinov.

(110)

4-EV/RV

CTGTGTTGAWACYTGAGCICCCA

5’NCR-VP4/VP2

Rhinov.762–743

55–59

48–57

 


a1, forward;2,reverse in first-round RT-PCR. b3, forward;4,reverse in nested PCR. cPrimer located up-stream from coding region for haemagglutinin gene. dGene position referred to Poliovirus1strain Sabin (Accession no. V01150). Note: All rhinoviruses have a deletion of approximately 116 bp as regards enteroviruses.

Gunson et al., in 2005, described a real-time RT-PCR multiplex assay for the detection of 12 respiratory viral infections using a triplex reaction. Specific labeled probes enabled the convenient interpretation of results as generated by the multiplex format.

Table 3: Primers and probes used in triplex real-time RT-PCR assays (Adapted from Gunson et al. in 2005).

Triplex

Pathogen

Primer(s) (5’–3’ ; [c] nM)

Probe (5’–3’); [c] nM

Target

 

 

 

 

 

1

Influenza A

AAAGCGAATTTCAGTGTGAT (1000)

6FAM-CCCTCTTCGGTGAAAGCCCT-BHQ (300)

NS1 gene

 

 

GAAGGCAATGTGAGATTT (500)

 

 

 

 

 

 

 

 

Influenza B

GTCCATCAAGCTCCAGTTTT (1000)

VIC-CTTTGCCATACTCAATGAACAAAC-TAMRA (300)

Nucleoprotein gene

 

 

TCTTCTTACAGCTTGCTTGC (500)

 

 

 

 

 

 

 

 

Human metapneumovirus

AACCGTGTACTAAGTGATGCACTC (500)

VIC-CTTTGCCATACTCAATGAACAAAC-TAMRA (300)

Nucleocapsid protein gene

 

 

CATTGTTTGACCGGCCCCATAA (500)

 

 

 

 

 

 

 

2

RSV A

AGATCAACTTCTGTCATCCAGCAA (1000)

6FAM-CACCATCCAACGGAGCACAGGAGAT-BHQ (300)

Nucleocapsid protein gene

 

 

TTCTGCACATCATAATTAGGAG (250)

 

 

 

 

 

 

 

 

RSV B

AAGATGCAAATCATAAATTCACAGGA (1000)

CY5-TTTCCCTTCCTAACCTGGACATA-BHQ (300)

 

 

 

TGATATCCAGCATCTTTAAGTA (1000)