Live Chat Support Software
800.227.0627

RNA copy number quantification with MERFISH

An improved MERFISH protocol enables the quantification of RNA copy numbers for the characterization of cell-to-cell variability as well as their localizing their spatial position.

In 2018, Wang et al. used an image-based single-cell transcriptomics approach called multiplexed error-robust fluorescence in situ hybridization (MERFISH) for the identification of hundreds to thousands of RNA species in individual cells. The new enhanced Multiplexed fluorescence in situ hybridization (FISH) combined with in situ sequencing is reported to allow profiling the expressions of a large number of RNA species in single cells.

MERFISH identifies RNAs via combinatorial labeling encoding RNA species with error-robust barcodes followed by sequential rounds of single-molecule FISH (smFISH) to read out these barcodes. The combination of MERFISH with expansion microscopy substantially increased the total density of measured RNAs. Wang et al. demonstrated the accurate identification and counting of RNAs, with a near 100% detection efficiency. The researchers utilized a ~130-RNA library composed of many high-abundance RNAs. Furthermore, MERFISH can be combined with immunofluorescence methods in expanded samples.


MERFISH utilizes binary barcodes which are determined by the presence or absence of fluorescence in a single round of hybridization and imaging. The barcode is built up one bit at a time via a series of smFISH measurements using the same sample. The protocol is descriped in the 2015 paper by 
Chen et al..

The primer sequences used in the 140-gene and 1001-gene experiments (Chen et al.). 

Experiment Name

Primer 1 Sequence (Index Primer 1)

Primer 2 Sequence

(T7 promoter plus the reverse complement of Index Primer 2)

140-gene Codebook 1

GTTGGTCGGCACTTGGGTGC

TAATACGACTCACTATAGGGAAAGCCGGTTCATCCGGTGG

140-gene Codebook 2

CGATGCGCCAATTCCGGTTC

TAATACGACTCACTATAGGGTGATCATCGCTCGCGGGTTG

1001-gene

CGCGGGCTATATGCGAACCG

TAATACGACTCACTATAGGGCGTGGAGGGCATACAACGC

 

Bit

Readout probes (Chen et al..)

1

CGCAACGCTTGGGACGGTTCCAATCGGATC/3Cy5Sp/

2

CGAATGCTCTGGCCTCGAACGAACGATAGC/3Cy5Sp/

3

ACAAATCCGACCAGATCGGACGATCATGGG/3Cy5Sp/

4

CAAGTATGCAGCGCGATTGACCGTCTCGTT/3Cy5Sp/

5

GCGGGAAGCACGTGGATTAGGGCATCGACC/3Cy5Sp/

6

AAGTCGTACGCCGATGCGCAGCAATTCACT/3Cy5Sp/

7

CGAAACATCGGCCACGGTCCCGTTGAACTT/3Cy5Sp/

8

ACGAATCCACCGTCCAGCGCGTCAAACAGA/3Cy5Sp/

9

CGCGAAATCCCCGTAACGAGCGTCCCTTGC/3Cy5Sp/

10

GCATGAGTTGCCTGGCGTTGCGACGACTAA/3Cy5Sp/

11

CCGTCGTCTCCGGTCCACCGTTGCGCTTAC/3Cy5Sp/

12

GGCCAATGGCCCAGGTCCGTCACGCAATTT/3Cy5Sp/

13

TTGATCGAATCGGAGCGTAGCGGAATCTGC/3Cy5Sp/

14

CGCGCGGATCCGCTTGTCGGGAACGGATAC/3Cy5Sp/

15

GCCTCGATTACGACGGATGTAATTCGGCCG/3Cy5Sp/

16

GCCCGTATTCCCGCTTGCGAGTAGGGCAAT/3Cy5Sp/


Reference

Wang, G., Moffitt, J.R. & Zhuang, X. Multiplexed imaging of high-density libraries of RNAs with MERFISH and expansion microscopy. Sci Rep 8, 4847 (2018). https://doi.org/10.1038/s41598-018-22297-7.

Moffitt JR, Zhuang X. RNA Imaging with Multiplexed Error-Robust Fluorescence In Situ Hybridization (MERFISH). Methods Enzymol. 2016;572:1-49. doi: 10.1016/bs.mie.2016.03.020. Epub 2016 Apr 27. PMID: 27241748; PMCID: PMC5023431.


Chen KH, Boettiger AN, Moffitt JR, Wang S, Zhuang X. Spatially resolved, highly multiplexed RNA profiling in single cells. Science. 2015;348:aaa6090. [
PMC] [PubMed

Zhuang Research Lab at Harvard: MERFISH Data and Protocols



---...---