Live Chat Support Software
800.227.0627

Coronavirus Diagnostic Assay 022520

The new coronavirus 2019-nCoV recently identified in patients with acute respiratory disease is genetically similar to SARS coronavirus and bat SARS-like coronavirus. Accurate molecular tests are needed for early detection and identification of infected patients. For this purpose, Chu et al. recently designed two 1-step quantitative real-time reverse-transcription PCR assays for the detection of regions ORF1B and N of the viral genome.

Real-time RT-PCR assays targeting the ORF1b and N gene regions of 2019-nCoV were designed based on the first publicly available sequence in Genbank (Accession number:  
MN908947). Regions (ORF1b and N) that are highly conserved amongst sarbecoviruses were selected for primer and probe designs.

Primers and Probes

Name

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

Working Conc.

 

 

ORF1b gene

 

 

ORF1b-F

 

TGGGGYTTTACRGGTAACCT

Y = C/T, R = A/G

18816 TGGGGTTTTACAGGTAACCT 18835      

 Sequence ID:  MT093631.1 29911

Present in 2019-nCoVs, SARS, bat-SARS, BetaCov and other coronaviruses.

 

 0.5 nmol/ml

ORF1b-R

 

 

AACRCGCTTAACAAAGCACTC

R = A/G

18947  AACACGCTTAACAAAGCACTC  18927

Present in 2019-nCoVs, SARS, bat-SARS, BetaCov and other coronaviruses.

 




0.5 nmol/ml

 

Probe

FAM

TAGTTGTGATGCWATCATGACTAG

W = A/T

18887  TAGTTGTGATGCAATCATGACTAG  18910

Present in 2019-nCoVs, SARS, bat-SARS, BetaCov, Pangolin CoV, and Bat coronavirus.

ZEN



0.25 nmol/ml

Name

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

Working Conc.

 

 

N gene

 

 

N-F

 

29183  TAATCAGACAAGGAACTGATTA  29204

 

Present in 2019-nCoVs, SARS, bat-SARS, BetaCov and other coronaviruses.

 

0.5 nmol/ml

N-R

 

 

29292  CGAAGGTGTGACTTCCATG  29274  

Present in 2019-nCoVs, SARS, bat-SARS, BetaCov and other coronaviruses.

 

 

0.5 nmol/ml

 

Probe

FAM

 

29234  GCAAATTGTGCAATTTGCGG  29215

Present in 2019-nCoVs, SARS, bat-SARS, BetaCov, Pangolin CoV, and Bat coronavirus.

ZEN

 

0.25 nmol/ml


Typical RT-PCR Condition

Extraction

For RNA and DNA extractions use a viral RNA purification kit (e,g. QIAamp Viral RNA Mini Kit, Qiagen) and a DNA plasmid purification kit (e.g. QIAprep Spin Miniprep Kit, Qiagen). Follow the instructed of the manual from the manufacturer. Typical volumes are: RNA extractions, use ~140 µL of sample and eluted in 60 µL elution buffer containing poly(A) carrier RNA.

PCR

For a total volume of 20 μl reaction use 4 μl of 4X master reaction mixture (e.g. TagMan Fast Virus 1-Step Master Mix, ThermoFisher), 0.5 nmol/ml of forward primer, 0.5 nmol/ml of reverse primer, 0.24 nmol/ml of the probe, and 4 μl of RNA sample.

Use a RT-PCR system for PCR reactions as follows: Reverse transcription at 50 °C for 5 minutes, inactivation at 95 °C for 20 seconds, 30 to 40 cycles of PCR amplification (Denaturing at 95 °C for 5 seconds; Annealing/extension at 60 °C for 30 seconds). The duration of a RT-PCR usually is in the range of 1 hour 15 minutes to 2 hours.

Reference

Daniel K W Chu, Yang Pan, Samuel M S Cheng, Kenrie P Y Hui, Pavithra Krishnan, Yingzhi Liu, Daisy Y M Ng, Carrie K C Wan, Peng Yang, Quanyi Wang, Malik Peiris, Leo L M Poon, Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia, Clinical Chemistry, , hvaa029, 
https://doi.org/10.1093/clinchem/hvaa029

---...---