⌘ Services

Are animals, including dogs, sensitive to coronavirus infections

The answer is yes.

Coronaviruses can infect dogs, cats, pigs, horses, chickens, mice, and rats, as well as other animals.


Coronaviruses are a large group of RNA viruses that can infect many animal species. Their replication mechanism involves recombination and mutation events that sometimes allow cross-species transmission. The ongoing change of the host's environment can favor cross-species transmission, which can turn into a threat to other species and the human population.

In animals, coronavirus infections are usually enzootic. Meaning the virus can be present in an animal population for a long time. However, only a small number of animals are affected at any one time. Animals are the primary source of the reservoir for recombination and transmission of coronaviruses. The 2020 SARS-CoV-2 pandemic promoted a global interest in animal coronaviruses, both in wild and domestic animals.

Therefore it is essential to understand the clinical outcome of coronavirus infections in different animals. Also, knowing their molecular characteristics helps to prevent new coronavirus diseases. Hence, coronavirus infections in animals may need to be routinely studied in veterinary medicine to prevent animal disease and promote public health.

Animal coronaviruses

The Coronaviridae or coronavirus family members are enveloped, generally spherical, with diameters of between 120 and 160 nm. The trimeric S or spike envelope protein appears in an electron microscope as characteristic projections giving the virus a crown-like appearance.

Models of the SARS-CoV-2 structure


Canine coronavirus (CCoV) is a member of the family Coronaviridae. CCoV is an enveloped, single-stranded, positive-sense RNA virus. CCoV causes mild to severe enteritis, inflammation of the intestine in pups. In dog pups, CCoV infection can cause severe diarrhea, vomiting, dehydration, loss of appetite, and, occasionally, death. CCoV shedding in feces occurs for 6 to 9 days after infection. PCR has detected long-term viral shedding in CCoV infected pups. 

CCoV belongs to the group I coronaviruses. This goup also includes the transmissible gastroenteritis virus of swine (TGEV), the porcine epidemic diarrhoea virus (PEDV), the porcine respiratory coronavirus (PRCoV), the feline coronaviruses (FCoVs) and the human coronavirus 229E (HCoV 229E).

Group I coronaviruses

TGEV              transmissible gastroenteritis virus of swine

PEDV              porcine respiratory coronavirus

FCoVs             feline coronaviruses

HCoV 229E    the human coronavirus 229E


Quantitative PCR

Quantitative fluorogenic reverse transcriptase-polymerase chain reaction (RT-PCR) assays allows the detection and quantitation of animal coronaviruses in the feces of infected animals. Decaro et al., in 2004, developed a primer and probe set useful for quantitative PCR (qPCR). 

The position and sequence of the primers and probe for TaqMan RT-PCR amplification are reported in Table1. 

Table 1:  Specific oligonucleotides used in CCoV fluorogenic assay and conventional RT-PCR for canine, feline and porcine CoVs.

Primer/probe

Sequence 5′→3′

Sense

Positiona

Amplicon size

CcoV1b

 TCCAGATATGTAATGTTCGG

  In canine, feline and porcine CoVs!

+

6729–6748

26498-26517

JQ404410.1

409 bp

CcoV2b

  TCTGTTGAGTAATCACCAGCT

−

7118–7138

 

CcoV-Forc

  TTGATCGTTTTTATAACGGTTCTACAA


+

6585–6611

99 bp

CcoV-Revc

  AATGGGCCATAATAGCCACATAAT

−

6660–6683

 

CcoV-Pbc

 FAMd-ACCTCAATTTAGCTGGTTCGTGTATGGCATT-TAMRAe

  M-gene

+

6620–6650

 

.
  aOligonucleotide position is referred to the sequence of CCoV strain Insavc-1 (accession no.: D13096).  bConventional RT-PCR (Pratelli et al., 1999).  cFluorogenic assay. dFAM, 6-carboxyfluorescein. eTAMRA, 6-carboxytetramethylrhodamine.

Reference

Buonavoglia C, Decaro N, Martella V, Elia G, Campolo M, Desario C, Castagnaro M, Tempesta M. Canine coronavirus highly pathogenic for dogs. Emerg Infect Dis. 2006 Mar;12(3):492-4. [PMC]

Colina SE, Serena MS, Echeverría MG, Metz GE. Clinical and molecular aspects of veterinary coronaviruses. Virus Res. 2021 Mar 8:198382. doi: 10.1016/j.virusres.2021.198382. [sciencedirect]

Decaro N, Pratelli A, Campolo M, Elia G, Martella V, Tempesta M, Buonavoglia C. Quantitation of canine coronavirus RNA in the faeces of dogs by TaqMan RT-PCR. J Virol Methods. 2004 Aug;119(2):145-50. [
PMC]

Pratelli A, Buonavoglia D, Martella V, Tempesta M, Lavazza A, Buonavoglia C. Diagnosis of canine coronavirus infection using nested-PCR. J. Virol. Methods. 2000;84:91–94. [PMC]

Pratelli A, Elia G, Martella V, Palmieri A, Cirone F, Tinelli A, Corrente M, Buonavoglia C. Prevalence of canine coronavirus (CCoV) antibodies in dogs in Bari, Italy, by an enzyme-linked immunosorbent assay. J. Virol. Methods. 2002;102:67–71. [PMC] 


---...---

Why Choose Bio-Synthesis

Trusted by biotech leaders worldwide for over 45 years of delivering high-quality, fast, and scalable synthetic biology solutions.