Services

What is a Bridged Nucleic Acid Polymerase Chain Reaction or BNA PCR

PCR (Bridged Nucleic Acid Polymerase Chain Reaction) is a variation of PCR that incorporates Bridged Nucleic Acids (BNAs) into PCR primer or probes. BNAs are synthetic nucleic acid analogs designed to enhance the stability and binding affinity of oligonucleotides. BNAs are chemically modified nucleotides that form stronger and more stable duplexes with complementary DNA or RNA sequences.

BNA PCR oligonucleotides have:

Increased Binding Affinity: BNA modifications strengthen the hybridization of primers or probes to their target sequences, improving specificity.

Enhanced Specificity: Due to their stronger binding, BNA-containing primers or probes can better discriminate between single nucleotide polymorphisms (SNPs).

Improved Sensitivity: BNA PCR can detect low-abundance target sequences with higher accuracy.

Resistance to Nucleases: BNAs provide enhanced stability against enzymatic degradation, useful for assays in challenging environments.

Applications

SNP Genotyping – BNA probes improve the discrimination of single nucleotide variations.

Molecular Diagnostics – Used in detecting mutations in genes associated with diseases like cancer.

MicroRNA Detection – BNAs enhance the detection of short RNA molecules by increasing hybridization stability.

Hirama et al. (2016) utilized BNAs to detect Clarithromycin-resistant Mycobacterium avium-M. Intracellular complex isolates. Nontuberculous mycobacteria are ubiquitous microorganisms found in many environments and are capable of causing several disorders in humans. The mycobacterium avium complex consists of multiple nontuberculosis mycobacterial species (NTM), which are hard to distinguish in the microbiology laboratory and require genetic testing. The M. avium complex is a nonmotile, non-spore-forming, gram-positive acid-fast bacillus. The complex is a slow-growing non-chromogen that takes about 10 to 20 days to develop mature colonies.

Antibiotic treatments using clarithromycin for bacterial infections include strep throat, pneumonia, skin infections, H. pylori infections, Lyme disease, etc. However, in recent decades, antimicrobial resistance to many bacteria has increased globally. Still, resistance patterns differ in relation to sex, age, ethnicity, lifestyle habits, socioeconomic status, geographic distribution, and national antibiotic consumption rates.

Hirama et al. developed a BNA probe detection system based on real-time PCR known as BNA-PCR to identify point mutations at position 2058 or 2059 in domain V of the 23S rRNA gene responsible for clarithromycin resistance. Application of the BNA-PCR showed that eight bacterial strains carried the point mutation at position 2058 or 2059 of the 23S rRNA gene. This analysis also revealed the presence of mycobacterial strains resistant to clarithromycin, which did not carry previously identified resistance genes.

Table 1: Primers and probes used for the study (Hirama et al.).

Primer/Probe

Target (GenBank accession #)

Sequence and Concentration [μM],

5’----3’

BNA-PCR for clarithromycin resistance gene

FW primer

23S rRNA (X74494)

GTAACGACTTCCCAACTGTCTC, 0.3

RV primer

 

ACCTATCCTACACAAACCGTACC. 0.3

BNA probeb

 

Alex532-CGCGGCAGGACGAAAAGAC-BHQ1, 0.3

Real-time PCR for M. avium identification

FW primer

ITSc 16–23S rRNA (AM709724)

AGCACCACGAAAAGCACTCCAATT, 0.3

RV primer

 

CGAACGCATCAGCCCTAAGGACTA, 0.3

TaqMan probe

 

FAM-TACCGGATAGGACCTCAAGACGC-TAMRA, 0.3

Real-time PCR for M. intracellulare identification

FW primer

ITSc 16–23S rRNA (AM709724)

AGCACCACGAAAAGCACTCCAATT, 0.3

RV primer

 

CGAACGCATCAGCCCTAAGGACTA, 0.3

TaqMan Probe

 

FAM-CCTGAGACAACACTCGGTCGATCC-TAMAR, 0.1

Sequencing of 23S rRNA M. avium or M. intracellulare

FW primer

23S rRNA (X74494)

ACCCGAAGCGGAGTGATCTACCCA, 0.3

FW primer

 

ATGTAGCGGGGCTCAAGCACACC, 0.3

FW primer

 

GATAAAAGGTACCCCGGGGATAAC, 0.3

 

aFW, forward; RV, reverse. bTwo BNA bases introduced at positions 2058 and 2059 corresponding to E. coili numbering AF053966.1 are highlighted in green. cITS, internal transcribed spacer.

See Hirama et al. for more detail.

Reference

Clarithromycin is an antibiotic for the treatment of bacterial infections including strep throat, pneumonia, skin infections, H. pylori infections, Lyme disease, and others.

Clarithromycin resistance Gastrojournal

Hirama T, Shiono A, Egashira H, Kishi E, Hagiwara K, Nakamura H, Kanazawa M, Nagata M. PCR-Based Rapid Identification System Using Bridged Nucleic Acids for Detection of Clarithromycin-Resistant Mycobacterium avium-M. intracellulare Complex Isolates. J Clin Microbiol. 2016 Mar;54(3):699-704. [PMC] [ASM]

Mycobacterium avium Complex [NBK431110]

---…---

Why Choose Bio-Synthesis

Trusted by biotech leaders worldwide for over 45 years of delivering high-quality, fast, and scalable synthetic biology solutions.