Live Chat Support Software
800.227.0627

Primer and Probe Sets for the detection of Omicron variants

 

Specific RT-qPCR assays enable rapid identification of newly emerging SARS-COV-2 variants such as the Omicron (B.1.1.529) virus variant of concern. The assays target characteristic mutations in the nsp6 (Orf1a), spike, and nucleocapsid genes. Also, multiplexing PCR may be a reliable assay to identify B.1.1.529 in suspected samples.

The Omicron variant (SARS-CoV-2 B.1.1.529) in November 2011 emerged in South Africa and Botswana. Travel-related cases were already identified in Hong Kong, Belgium, and Israel at the end of November. As of 01-11-2022 Omicron has now been discovered in all seven continents. However, since Omicron variants with and without deletions in the spike protein and others are co-circulating, the correct diagnose using PCR tests is complicated.

GISAID is tracking Omicron and other variants of SARS-CoV-2 and reported 271,805 Omicron genome sequences on 01-11-2022.

 

 



GISAID

 

Specific RT-qPCR assays enable rapid identification of newly emerging SARS-COV-2 variants such as the Omicron (B.1.1.529) virus variant of concern. The assays target characteristic mutations in the nsp6 (Orf1a), spike, and nucleocapsid genes. Also, multiplexing PCR may be a reliable assay to identify B.1.1.529 in suspected samples.

A list of mutations for a variety of variants can be reviewed at here

The Omicron variant (SARS-CoV-2 B.1.1.529) first emerged in November 2011 in South Africa and Botswana.

Travel-related cases were already identified in Hong Kong, Belgium, and Israel at the end of November.

As of 01-11-2022, Omicron has now been discovered in all seven continents. However, since Omicron variants with and without deletions in the spike protein and others are co-circulating, the correct diagnose using PCR tests is quite complicated.

GISAID is tracking Omicron and other variants of SARS-CoV-2 and reported 271,805 Omicron genome sequences on 01-11-2022.  Oran et al. recently reported four RT-qPCR assays that allow the rapid identification of the newly emerging SARS-CoV-2 Omicron variant of concern. With its 30 mutations in the spike protein alone, this variant of concern (VOC) can potentially increase transmissibility and reduce vaccine effectiveness. Therefore, assays that allow the specific detection of this variant are needed. RT-qPCR assays can be implemented and performed in any molecular diagnostic laboratory without requiring specific brand instruments or unique reagents.

Primer and Probes for Specific Detection of the Omicron Virus

Name

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

Working Conc. [μM]

Reference

   

N Protein

   

 

Ndel positive detection

 

 

 

 

 

28322 Fwd

None

TTTGGTGGACCCTCAGATTC

None

20 - 50

Oran et al. 2021

28424 Rev

None

CGCAGTATTATTGGGTAAACCTTG

None

20 - 50

28354 probe

FAM

CCAGAATGGTGCGGCGCGATC

OM185476.1 28279 to 28299; Etc.

BHQ1

5 - 10

Ndel negative detection

 

 

 

 

 

2019-nCoV_N1-F1a

None

CTAAACGAACAAACTAAAATGTCTG

None

20 - 50

Oran et al. 2021

2019-nCoV_N1-R1a

None

GCCCCACTGCGTTCTCCATTC

None

20 -50

US CDC

2019-nCoV_N1-P

FAM

ACCCCGCATTACGTTTGGTGGACC

LC666943.1 28293 to 28316; etc.

BHQ1

5 - 10

Oran et al. 2021

Sindel reaction

 

 

 

 

 

22174 Fwd

None

GTTATTTTAAAATATATTCTAAGCACACG

None

20 – 50

22248 Rev

None

TAAAGCCGAAAAACCCTGAG

None

20 - 50

22206 probe

FAM

ATTATAGTGCGTGAGCCAGAAGATCTCC

OM185480.1 22109 to 22136; etc.

BHQ1

5 - 10

Nsp6 deletion reaction

 

 

 

 

 

11248 B529 Fwd

None

ATATGGTTGATACTAGTTTTAAGC

None

20 -50

COV19_11344_R

None

ACACAGTTCTTGCTGTCATAAGG

None

20 -50

COV19_11310_P

FAM

CTGTGTTATGTATGCATCAGCTGTAGT

LC666933.1 11292 to 11318; etc.

BHQ1

5 – 10

 

E-sarbeco reaction

 

 

 

 

 

E_Sarbeco_F1b

None

GTTAATAGCGTACTTCTTTTTCTTGC

None

20 -50

Corman et al.

E_Sarbeco_R2

None

ATATTGCAGCAGTACGCACACA

None

20 – 50

E_Sarbeco_P1

TXRed

ACACTAGCCATCCTTACTGCGCTTCG

LC666943.1 26323 to 26348; etc.

BHQ2

 5 - 10

 

Note: TaqMan® or FRET probes are usually labeled at the 5′-end with the reporter molecule 6-carboxyfluorescein (FAM) and with the quencher, Black Hole Quencher 1 (BHQ-1) at the 3′-end. Alternatively, probes can also be labeled at the 5′-end with the reporter molecule 6- carboxyfluorescein (FAM) and with a double quencher ZEN™ Internal Quencher positioned between the ninth (9th) and tenth (10th) nucleotide base in the oligonucleotide sequence and Iowa Black® FQ (3IABkFQ) located at the 3’-end.

In addition, a ROX probe reaction mixture may be used as well.


Reference

Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, Bleicker T, Brünink S, Schneider J, Schmidt ML, Mulders DG, Haagmans BL, van der Veer B, van den Brink S, Wijsman L, Goderski G, Romette JL, Ellis J, Zambon M, Peiris M, Goossens H, Reusken C, Koopmans MP, Drosten C. 2020. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill 25:2000045. [PMC]

Oran Erster, Adi Beth-Din, Hadar Asraf, Virginia Levy, Areej Kabat, Batya Mannasse, Roberto Azar, Ohad Shifman, Shirley Lazar, Michal Mandelboim, Shay Fleishon, Ella Mendelson, Neta S Zuckerman; SPECIFIC DETECTION OF SARS-COV-2 B.1.1.529 (OMICRON) VARIANT BY FOUR RT-qPCR DIFFERENTIAL ASSAYS; medRxiv 2021.12.07.21267293;  [ 
medrxiv ]


US CDC Omicron Update


CDC COVID-19: SARS-CoV-2 Variant Classifications and Definitions

---...---

Bio-Synthesis provides a full spectrum of high quality custom oligonucleotide modification services including back-bone modifications, conjugation to fatty acids and lipids, cholesterol, tocopherol, peptides as well as biotinylation by direct solid-phase chemical synthesis or enzyme-assisted approaches to obtain artificially modified oligonucleotides, such as BNA antisense oligonucleotides, mRNAs or siRNAs, containing a natural or modified backbone, as well as base, sugar and internucleotide linkages.
Bio-Synthesis also provides biotinylated mRNA and long circular oligonucleotides.
---...---