Services

Telomere FISH probes for repeat sequences

Telomere repeat sequences for FISH probes

Repeat sequences in telomeres are useful candidates for the synthesis of telomeric FISH probes also called TeloFISH probes. 
 
Telomeres are DNA structures at the ends of eukaryotic chromosomes that protect them from degradation and DNA repair activities. Initially, telomeres were defined functionally as the natural ends of eukaryotic chromosomes. Without telomeres, a chromosome is unstable. Telomeric DNA consists of simple sequences repeated in tandem. These sequence stretchers have been found to be a conserved feature in throughout eukaryotes. The terminal DNA stretch can range in total length from under fifty base pairs in some protozoans, through a few hundred base pairs in yeasts and several other eukaryotes, to thousands of base pairs in mammalian cells. These sequence repeats appear to maintain a stable telomere. For this reason, telomeres can be functionally defined as regions of DNA at the end of linear chromosomes. Apparently these sequence repeat regions are needed for replication and stability of chromosomes. All known eukaryotic telomeres contain simple repeated sequences of G- and C-rich complementary strands. These telomere repeat sequences have the general structure (T or A)m(G)n. In Tetrahymena and Oxytricha the G-rich DNA strand, oriented in a 5' - 3' direction toward the end of the chromosome, is synthesized by an RNA-dependent "telomerase" activity.

Protein telomere with telomere repeat sequence complex in Sterkiella nova

In Sterkiella nova, alpha and beta telomere proteins bind cooperatively with single-stranded DNA to form a ternary alpha.beta.DNA complex. The association of telomere protein subunits is DNA-dependent. The alpha-beta association enhances DNA affinity. To further understand the molecular basis for binding cooperativity, Buczek and Horvath in 2006 characterized several possible stepwise assembly pathways using isothermal titration calorimetry.

The enzyme telomerase is a reverse transcriptase that elongates telomeres in the cells it is expressed in. Telomerase was found to be active in germ cells and stem cell populations but not in adult tissue cells. In normal adult tissue cells or somatic cells the telomere activity levels are not sufficient to prevent telomere shortening associated with cell division. During the lifetime of an organism including humans the number of times a normal human cell population will divide until cell division stops appear to be finite. However, cancer cell lines can almost live on forever and are considered to be immortal.

Chromosomes can be stained with fluorescently or otherwise labeled oligonucleotide probes directed against highly conserved telomere repeat sequences.

In general, to stain chromosomes during in-situ hybridization experiments labeled oligonucleotide probes directed against highly conserved mammalian telomere repeat sequences and against major satellite repeats are used. Popular probes of this type contain the fluorogenic dyes Cy3 or FITC at the 5’ or 3’ end.  Artificial nucleotides, such as bridged nucleic acids or BNAs, can be used to enhance the specificity of the probes.

For example molecular probes that target the (TTAGG)4 repeat are often used for the detection and staining of  highly conserved sequence repeats consisting of (TTAGGG)n and (CCCTTA)n sequences in human chromosomes. Human chromosomes contain stretches of up to 30,000 C and G bases repeating over and over. These sequence stretches often occur adjacent to gene-rich areas and form a barrier between the genes and the non-coding DNA. In general many FISH probes are targeted towards repetitive sequences found in the chromosomes. Scientists now believe that CpG islands are involved in regulating gene activities and more evidence has been accumulated recently to support the functional significance of satellite DNA sequences.

Structure of probes used for the staining of chromosomes


A typical non-radioactive probe consists of a fluorophore that is conjugated to the 5’- or 3’-end of the oligonucleotide used.


Telomer Probe:  Fluorophore-5’-CCC TAA CCC TAA CCC TAA-3’


Centromere Probe:  Fluorophore-5’-TCG CCA TAT TCC AGG TC-3’

Target:  Mouse major satellite repeats.

Structure of the human telomere in K+ solution

An intramolecular (3 + 1) G-quadruplex scaffold.



Ref.: Luu, K.N.,  Phan, A.T.,  Kuryavyi, V.V.,  Lacroix, L.,  Patel, D.J.; (2006) J.Am.Chem.Soc. 128: 9963-9970.

Abstract

We present the intramolecular G-quadruplex structure of human telomeric DNA in physiologically relevant K(+) solution. This G-quadruplex, whose (3 + 1) topology differs from folds reported previously in Na(+) solution and in a K(+)-containing crystal, involves the following: one anti.syn.syn.syn and two syn.anti.anti.anti G-tetrads; one double-chain reversal and two edgewise loops; three G-tracts oriented in one direction and the fourth in the opposite direction. The topological characteristics of this (3 + 1) G-quadruplex scaffold should provide a unique platform for structure-based anticancer drug design targeted to human telomeric DNA.
 

Telomeric repeat sequences in eukaryotes

Organism

Telomeric repeat

(5' to 3' toward the end)

Reference

Vertebrates, human

TTAGGG n repeats

Meyne et al. 1989

Giardia lamblia

TAGGG

Adam et al. 1991

Human, mouse, Xenopus, Neurospora crassa, Trypanosoma brucci, Aspergillus nidulans

TTAGGG

Bhattacharyya and Blackburn 1997b

Neurospora crassa

Cryptococcus

TTAGGG

TTAGGGGG

 

Edman 1992

Physarum, Didymium,

TTAGGG

 

Dictyostelium

AG(1-8)

 

Trypanosoma, Crithidia

TTAGGG

 

Tetrahymena, Glaucoma

TTGGGG

 

Paramecium

TTGGG(T/G)

 

Oxytricha, Stylonychia, Euplotes

TTTTGGGG

 

Plasmodium

TTAGGG(T/C)

TT(T/C)AGGG

 

Arabidopsis thaliana

TTTAGGG

 

Chlamydomonas

TTTTAGGG

 

Bombyx mori

TTAGG

 

Ascaris lumbricoides

(C)TTAGG(C)

Muller et al. 1991

Schizosaccharomyces pombe

TTAC(A)(C)G(1-8)

TTAC(A)AG2-7

 

Saccharomyces cerevisiae

TGTGGGTGTGGTG

(from RNA template)
or G(2-3)(TG)(1-6)T

(consensus)

TG2-3(TG)1-3

 

Saccharomyces castellii

TCTGGGTG

 

Candida glabrata

GGGGTCTGGGTGCTG

 

Candida albicans

GGTGTACGGATGTCTAACTTCTT

 

Candida tropicalis

GGTGTA[C/A]GGATGTCACGATCATT

 

Candida maltose

GGTGTACGGATGCAGACTCGCTT

 

Candida guillermondii

GGTGTAC

 

Candida pseudotropicalis

GGTGTACGGATTTGATTAGTTATGT

 

Kluyveromyces lactis

GGTGTACGGATTTGATTAGGTATGT

McEachern and Blackburn 1996

 

Reference

Adam R.D., Nash T.E., and Wellems T.E., 1991. Telomeric location of Giardia rDNA genes. Mol. Cell. Biol. 11: 3326-3330.

Blackburn, E. H. & Szostak, J. W. (1984) Annu. Rev. Biochem. 53, 163-194.

Buczek P, Horvath MP; Structural reorganization and the cooperative binding of single-stranded telomere DNA in sterkiella nova. J.Biol.Chem. (2006) 281 p.40124.

The RNA World, Second edition. Gesteland, Chech, Atkins, CSHL Press.

 

Links to data bases

http://telomerase.asu.edu/

http://labs.fhcrc.org/bedalov/telomeredatabase.html

http://www.biophysica.com/telomere.html

http://www.rcsb.org/pdb/results/results.do?outformat=&qrid=31238D90&tabtoshow=Current

 

 

Why Choose Bio-Synthesis

Trusted by biotech leaders worldwide for over 45 years of delivering high-quality, fast, and scalable synthetic biology solutions.