Use of Photocleavable Linkers in CRISPR Guide RNAs
Incorporating photocleavable (PC) molecular compounds, such as o-nitrobenzyl derivatives or PC linkers, into guide RNAs allows light-regulated spatiotemporal control of CRISPR activities. The precise position of the PC linkers dictates whether light acts as an ON-switch, activating the CRISPR system, or an OFF-switch, deactivating or inactivating the CRISPR system.
Photolabile linkers allow light-mediated deactivation of CRISPR systems
In light-mediated CRISPR systems, Cas9 is assembled with a photocleavable guide RNA (pcRNA). The complex recognizes and cleaves its target DNA normally. Light exposure with the appropriate wavelength triggers cleavage of the photolabile linker embedded within the guide RNA. The guide RNA is fragmented and can no longer properly direct Cas9 to its target. Cas9 loses functional targeting capability and genome editing stops rapidly, enabling precise temporal control over editing duration. [Sakovina et al. 2014]
Seed Region Modifications with Light-Activated / ON-OFF Switches
Strategically incorporating PC groups or PC phosphodiester backbone linkers within the seed region (positions 1 to 8 relative to the PAM) disrupts base pairing with the target DNA or prevents proper conformational activation of the Cas endonuclease. UV to violet light illumination around ~365 to 405 nm cleaves the PC moiety, restoring Watson-Crick base pairing capability or removing steric hindrance, thereby rapidly turning ON cleavage or transcription activity. Common modification positions include positions 1 to 6 of the seed regions in Cas9 sgRNA or Cas12a crRNA.
Blocking Oligonucleotide / Protector Strand, Light-Activated / ON-Switch
In this approach, the core guide is modified directly. A complementary "protector" strand containing PC linkers hybridizes to the spacer domain, forming an inactive duplex used as a caged guide. Light irradiation cleaves the protector oligonucleotide into shorter fragments that spontaneously dissociate, liberating the single-stranded guide region to bind the target DNA.
Earlier light-activated approaches: Adding a 2-nitrobenzyl group to the 5’-end of ATP (caging of ATP)
PC compounds were utilized for kinetic studies as early as 1978. Kaplan et al. (1978) and McCray et al. (1980) showed that 2-nitrobenzyl phosphate and 1-(2-nitro) phenylethyl phosphate allow the attachment of these photolabile groups to adenosine 5’-triphosphate for the synthesis of "caged ATP." This caged ATP can serve as a stable source of unmetabolizable ATP until light activation releases free ATP.
Ohtsuka et al. (1979) reported the synthesis of p1-adenosine 5’-P2-o-nitrobenzyl pyrophosphate used as a substrate for T4 RNA ligase-catalyzed 3’-phosphorylation. The researchers phosphorylated a trinucleotide U-A-G using the photo-labeled adenosine with the help of the RNA ligase after photochemical removal of the o-nitrobenzyl group.
Lusic et al. (2007) synthesized a photocaged nucleoside for incorporation into DNA under standard synthesis conditions, enabling disruption of specific H-bonds and analysis of their contribution to DNAzyme activity. Brief irradiation with non-photodamaging UV light caused rapid decaging and near-quantitative restoration of DNAzyme activity.
| Caged ATP (2-nitrobenzyl-ATP) |
| | |
| Stick model | Surface model |
Light-induced photolysis of caged ATP results in the formation of 2-nitrosoacetophenone and a proton, depending on the ionization state of ATP.
Spatial and temporal control of biomolecules
Klán et al. (2013) reviewed the use of photoremovable, sometimes called photo-releasable, photocleavable, or photoactivatable, protecting groups (PPGs) for the design of spatial and temporally controlled release from various cached bioagents, including neurotransmitters, cell-signaling molecules, acids, bases, Ca2+ ions, oxidants, insecticides, pheromones, fragrances, and others, for the study of their kinetics.
Photoactivatable Cas9 systems
Combining CRISPR-Cas9 with optogenetic technologies allows the design of engineered photoactivatable Cas9 to control genomic sequences with precise spatiotemporal control. Nihongaki et al. (2015) described an engineered photoactivatable Cas9 (paCas9) system that enables optogenetic control of CRISPR-Cas9 genome editing in human cells. paCas9 consists of split Cas9 fragments and photoinducible dimerization domains named Magnets. Blue light irradiation of paCas9 expressed in human embryonic kidney 293T cells induces targeted genome sequence modifications through both nonhomologous end joining and homology-directed repair pathways.
Photoactivatable CRISPR‑Cas9 systems integrate CRISPR genome editing with optogenetics to achieve reversible, spatiotemporally precise control of DNA cleavage. In this approach, Cas9 is split into two inactive fragments, and each is fused to light‑responsive dimerization proteins. Upon illumination, typically using blue light, the fragments reassemble into an active nuclease. Blue light induces dimerization of the fused Magnet domains, reconstituting active Cas9. Turning off the light halts Cas9 activity. Gene editing can be restricted to illuminated regions of a cell culture, and the activation windows can be tightly controlled to reduce off‑target effects. Photoactivatable CRISPR‑Cas9 represents a major advance in achieving precise, reversible, and spatially confined genome editing.
Jain et al. (2016) introduced "CRISPR-plus" (CRISPR-precise light-mediated unveiling of sgRNAs), a method for photo-caging single-guide RNAs (sgRNAs) to enable light-activated, remote-controlled CRISPR/Cas9 gene editing. Here, light controls CRISPR simply by hybridizing a single chimeric guide RNA (sgRNA) with its complementary oligonucleotide containing photocleavable groups. The modified blocking oligonucleotide is called a protector oligonucleotide. The protected sgRNA (p-sgRNA) remains inactive, blocking CRISPR activity, until a remote light trigger cleaves the protector oligonucleotides. This method allows "caging," or temporary blocking, of guide RNA activity by hybridizing it with a complementary DNA oligonucleotide containing photocleavable protector strands. Upon light exposure (UV irradiation), the protectors are cleaved and fall away, unlocking and activating the sgRNA to direct Cas9 cleavage. This CRISPR-plus system supports multiplexing by targeting multiple DNA sequences simultaneously and compatible with guide RNA labeling for downstream imaging and mechanistic cell studies.
Rose et al. (2017) developed a chemically inducible Cas9 (ciCas9) variant coupled with droplet digital PCR for double-strand breaks (DSB-ddPCR) to measure and quantify CRISPR-Cas9 genome editing and repair kinetics in real time. Medhi and Jasin (2020) added light-sensitive nucleotides to parts of the guide RNA to speed up the CRISPR-Cas9 gene-editing process and called it very fast CRISPR (vfCRISPR). Because of the "caged approach," the guide is restrained until light releases it to carry out its job.
| Linker for photolabile blocking oligonucleotides | Light induced fragmentation of photolabile oligonucleotides |
| | |
Liu et al. (2020) introduced very fast CRISPR (vfCRISPR), a light-activated genome-editing technology that triggers DNA double-strand breaks within seconds at sub-micrometer resolutions. The system integrates photocaged nucleotides into the single guide RNA (sgRNA) protospacer region. The Cas9-gRNA complex can bind to its target DNA sequence without cutting it before light activation. Exposure to UV light at 365 to 405 nm or laser stimulation removes the caging groups, activating the pre-bound complex for rapid cleavage and enabling researchers to study DNA double-strand break repair kinetics with high temporal precision, including imaging-guided activation of Cas9 within specific subnuclear volumes down to single-allele resolution.
Zou et al. (2021) developed a method to deactivate CRISPR in mammalian cells using photocleavable guide RNAs (pcRNAs), allowing researchers to switch off CRISPR-Cas9 activity on demand with light. Here, the guide RNA is engineered with a light-sensitive chemical linker that breaks upon illumination, rendering the guide RNA nonfunctional and rapidly terminating genome-editing activity.
CRISPR RNAs used by Zou et al.:
TracrRNA AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU
Pcl5_HEKsite4 GGCACPGCGGCUGGAGGUGGGUUUUAGAGCUAUGCUGUUUUG, P is placed in position 6
gRNA_HEKsite4 GGCACTGCGGCTGGAGGTGGGUUUUAGAGCUAUGCU
Sakovina et al. (2024) showed that both sgRNA and a pair of crRNA and tracrRNA can be used to guide Cas9 nuclease activity and that these crRNAs can be destroyed by relatively mild UVA irradiation with rate constants of 0.24 to 0.77 min−1. In model in vitro systems, the photocleavage reaction slowed Cas9 nuclease activity. Adding two photolinkers resulted in faster crRNA destruction than a single linker. Photolinkers in the crRNA structure improved Cas9 nuclease specificity for complementary DNA targets. Using photocleavable crRNA in CRISPR/Cas9 genome editing allows spatiotemporally controlled switching off of the system with fewer off-target effects. The researchers designed photocleavable crisper RNAs (crRNAs) carrying nucleotide modifications at position 2′-fluoro or using locked nucleic acids (LNAs) to improve the biological properties of crRNAs by synthesizing native (R) and modified (F, 2′-fluoro, and L, LNA) photocleavable crRNA and non-modified tracrRNA (trR) using solid-phase phosphoramidite synthesis. The phosphoramidite monomer 1-(2-nitrophenyl)-1,2-ethanediol was used for the incorporation of photolabile linkers.
The photocleavable linker sequences were designed to be either fully complementary to crRNA (DNA1) or to contain a single A:C mismatch at position 5 (DNA2) or 7 (DNA3) in the non-seed region. Introducing one or two 1-(2-nitrophenyl)-1,2-ethanediol linkers into the oligonucleotide strand allowed crRNA fragmentation to be turned on in a spatially and temporally controlled manner, switching the CRISPR/Cas9 system off.
| One linker system | Two linker system |
| | |
Placement of photo-linkers in crRNA
F = 2’-fluoro pyrimidine nucleotide, PL = 1-(2-nitrophenyl)-1,2-ethanediol linker, L = LNA-thymidine. The fragment of crRNA complementary to the DNA protospacer is underlined. See Sakovina et al. for more details.
References
Jain PK, Ramanan V, Schepers AG, Dalvie NS, Panda A, Fleming HE, Bhatia SN. Development of Light-Activated CRISPR Using Guide RNAs with Photocleavable Protectors. Angew Chem Int Ed Engl. 2016 Sep 26;55(40):12440-4. [PMC]
Kaplan JH, Forbush B, Hoffman JF; Rapid photolytic release of adenosine 5'-triphosphate from a protected analog: utilization by the sodium:potassium pump of human red blood cell ghosts. Biochemistry 1 May 1978; 17 (10): 1929–1935. [ https://doi.org/10.1021/bi00603a020]
Klán P, Šolomek T, Bochet CG, Blanc A, Givens R, Rubina M, Popik V, Kostikov A, Wirz J. Photoremovable protecting groups in chemistry and biology: reaction mechanisms and efficacy. Chem Rev. 2013 Jan 9;113(1):119-91. [PMC]
Liu Y, Zou RS, He S, Nihongaki Y, Li X, Razavi S, Wu B, Ha T. Very fast CRISPR on demand. Science. 2020 Jun 12;368(6496):1265-1269. [PMC]
Lusic H, Young DD, Lively MO, Deiters A. Photochemical DNA activation. Org Lett. 2007 May 10;9(10):1903-6. [PMC]
McCray JA, Herbette L, Kihara T, Trentham DR. A new approach to time-resolved studies of ATP-requiring biological systems; laser flash photolysis of caged ATP. Proc Natl Acad Sci U S A. 1980 Dec;77(12):7237-41.
Medhi D, Jasin M. CRISPR at lightning speeds. Science. 2020 Jun 12;368(6496):1180-1181. [PubMed]
Nihongaki Y, Kawano F, Nakajima T, Sato M. Photoactivatable CRISPR-Cas9 for optogenetic genome editing. Nat. Biotechnol. 2015;33:755–760. [PubMed]
Ohtsuka E, Uemura H, Doi T, Miyake T, Nishikawa S, Ikehara M. A new method for 3'-labelling of polyribonucleotides by phosphorylation with RNA ligase and its application to the 3'-modification for joining reactions. Nucleic Acids Res. 1979 Feb;6(2):443-54. [PMC]
Rose JC, Stephany JJ, Valente WJ, Trevillian BM, Dang HV, Bielas JH, Maly DJ, Fowler DM. Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Sep;14(9):891-896. [PMC]
Sakovina L, Vokhtantsev I, Akhmetova E, Vorobyeva M, Vorobjev P, Zharkov DO, Novopashina D. Photocleavable Guide crRNAs for a Light-Controllable CRISPR/Cas9 System. Int J Mol Sci. 2024 Nov 19;25(22):12392. [PubMed, PMC]
Zou RS, Liu Y, Ha T. CRISPR deactivation in mammalian cells using photocleavable guide RNAs. STAR Protoc. 2021 Oct 20;2(4):100909. [PMC]
Zou RS, Liu Y, Wu B, Ha T. Cas9 deactivation with photocleavable guide RNAs. Mol Cell. 2021 Apr 1;81(7):1553-1565.e8. [PMC]