Services

A Novel BNA Probes Bead Based Assay

A novel bead-based suspension assay using BNA-NC probes to detect and quantify somatic mutations in leukemia

A novel bead-based suspension assay using Bridged Nucleic Acid, BNA-NC, probes for the Luminex (USA) LabScan200 flow platform was develop and validated by Shivarov et al. in 2014. This assay allows quantitative detection of DNMT3A p.R882C/H/R/S mutations. The comparison with LNA based probes revealed the superior hybridization characteristics of the BNA based probes. The researchers demonstrated for the first time the benefit of BNA-NC probes coupled to fluorescently labeled beads for quantitative detection of DNMT3A R882 mutations. This type of assay adds to the list of molecular diagnostics techniques used for the analysis of biological markers in genomic and proteomic research. The specific diagnosis and monitoring of diseases enables detection and evaluation of disease risks for individual patients. By analyzing the specifics of a patient’s disease, molecular diagnostics offers the promise to enable and optimize personalized medicine.

Leukemia is an often malignant blood disease that has the tendency to become progressively worse. This type of cancer of the blood or bone marrow is characterized by an abnormal increase of immature white blood cells. However, the term leukemia is also used to cover a whole spectrum of diseases affecting the blood, bone marrow, and lymphoid system, all known as hematological neoplasms. Leukemia is now considered to be a treatable disease. Several hematologic malignant tumors are characterized by genome instabilities. As identified by whole genome sequencing, these cancer types frequently have between 10,000 and 100,000 mutations in their entire genomes. Mutations in the human DNA methyl transferase 3A (DNMT3A) gene have now been identified in several blood diseases. The methyl-group transferring enzyme, DNA methyltransferase 3A (DNMT3A) is one of two human de novo DNA methyltransferases essential for the regulation of gene expression and mutations. and deletions in this protein have been observed in acute myeloid leukemia (AML), Acute lymphoblastic leukemia (ALL), myelodysplastic sydromes and myeloproliferative neoplasms. Myeloid cells represent a prominent part of local inflammatory infiltrates in the central nervous system (CNS) and appear to strongly contribute to the local inflammatory milieu and the pathological outcome of diseases involving these cells.

Kim et al. in 2013 used PCR and direct sequencing to analyze mutations of DNMT3A amino acid residue R882 in 99 acute leukemia patients, including 57 AML patients, 41 ALL patients and a single biphenotypic acute leukemia (BAL) patient. The most common immunophenotype  in BAL patients is defined by the coexpression of B-lymphoid and myeloid markers and less frequently, T-lymphoid and myeloid markers. BAL has a high incidence of clonal chromosomal abnormalities, the most common being the t(9;22) (q34;q11) (Ph chromosome) and structural abnormalities involving 11q23. Data are emerging that BAL has a negative prognosis in both children and adults and this may be related to the underlying chromosome abnormalities. The research group detected DNMT3A expression in mononuclear cells of the bone marrow in these patients and in normal individuals using real‑time quantitative polymerase chain reaction. Approximately 17.5% (10/57) of AML patients were found to exhibit DNMT3A mutations, and four missense mutations were observed in the DNMT3A‑mutated AML patients, including R882 mutations and a novel single nucleotide polymorphism resulting in a M880V amino acid substitution. It is now known that somatic heterozygous mutations of the DNA methyltransferase gene DNMT3A occur frequently in acute myeloid leukemia and other hematological malignancies. The majority (∼60%) of these affect a single amino acid, Arg882 (R882), located in the catalytic domain of the enzyme. In 2013, Kim et al. could show that exogenously expressed mouse Dnmt3a proteins that have the corresponding R878 mutations largely fail to mediate DNA methylation in murine embryonic stem (ES) cells but are capable of interacting with wild-type Dnmt3a and Dnmt3b. The coexpression of the Dnmt3a R878H (histidine) mutant protein resulted in inhibition of the wild-type Dnmt3a and Dnmt3b to methylate DNA in murine ES cells. In addition the expression of Dnmt3a R878H in ES cells containing endogenous Dnmt3a or Dnmt3b induced hypomethylation which suggests that the DNMT3A R882 mutations, in addition to being hypomorphic, have dominant-negative effects. The current literature suggests that the presence of DNMT3A mutations is an adverse prognosis biomarker in adult acute myeloid leukemia and that the rapid detection of DNMT3A R882 codon mutations allows for early identification of poor risk patients with acute myeloid leukemia.

Shivarov et al. therefore set out to develop a novel bead-based suspension assay using BNA-NC probes for the LabScan200 flow platform from Luminex, (USA). The research group developed and validated a bead-based method to quantitatively detect DNMT3A p.R882C/H/R/S mutations using BNA-NC-modified probes. The comparison with probes that were modified with LNAs, a first generation bridged-nucleic acid, revealed the superior hybridization characteristics for the BNA based probes. The researchers demonstrated for the first time the applicability of BNA-NC probes coupled to fluorescently labeled beads for quantitative detection of DNMT3A R882 mutations.

How does the assay work?

1.      Primers are designed to allow for the amplification of a DNA sequence fragment that contains the mutated sequence codon. One of the primers is labeled with biotin.

2.      First, human genomic DNA is extracted from blood.

3.      The exon 23 of the human DNMT3A gene is amplified using the selected forward and reverse primer.

4.      To determine the exact sequence the purified and amplified DNA can be sequenced using Big Dye terminator cycle-sequencing.

5.      Next, the exon 23 DNMT3A fragments are amplified from either genomic or plasmic DNA samples using a 5’-biotinylated forward primer.

6.      Genotyping is performed with the BNA-NC modified oligonucleotide probes connected to microsphere beads, specific for the wild type or the mutant alleles, by direct hybridization.

7.      The captured DNA fragment containing biotin on its 5’-end is detected with the help of streptavidin-phycoerythrine (SAPE) in the hybridization buffer using the LabScan200 flow platform from Luminex (USA). For more detail review Shivarov et al. 2014.  

The outline of the assay is illustrated as follows:


 

Bead-based suspension assay using BNA-NC probes

bead based suspension assay - 1

Figure 1:  Bead-based suspension assay using BNA-NC probes to detect and quantify somatic mutations in leukemia. The amplified DNA fragment containing the mutations is captured by the BNA/DNA probes and quantitatively detected with the help of the SAPE complex allowing the analysis in a Luminex system.

The following illustration explains how the assay works in the Luminex platform.

Bead-based suspension assay using BNA-NC probes

bead based suspension assay - 2

bead based suspension assay - 2

Figure 2:  Bead-based suspension assay using BNA-NC probes and the Luminex system to detect and quantify somatic mutations in leukemia.
1. Primers and probes are designed specific for the mutated sequence codons.
2. DNA is isolated from blood.
3. Amplified by PCR.
4. Biotinylated DNA fragments are captured with the capture probe connected to the beads.
5. 
Biotinylated DNA fragments are detected with a streptavidin-phycoerythrine (SAPE) complex.
6. The sample is analyzed using a Luminex instrument. The level of SAPE fluorescence is proportional to the amount of the captured DNA fragment.


To illustrate how primers and probes were designed, the location of primer and probe sequences along the DNMT3A reference gene sequence are illustrated in the following paragraph showing a partial sequence segment of the gene containing the mutated target codon.


Sequence Fragment for the DNMT3A gene: gi|340523094|ref|NG_029465.1| Homo sapiens DNA (cytosine-5-)-methyltransferase 3 alpha (DNMT3A), RefSeqGene on chromosome 2:

----

TTTTTCGCCTTCCCTGCTCTTGATGGGGAGGATGCTAGGGCTACGTGTTCGTTACATGCAGACTCCAGGTGTACGTTGCC

GAGCTAACCCTGCAGGAGAGGAGAACTAGAGAGTGTGTCCTGGAGGTATTTCTGAGGGATTGTTCAAAATTACTCTTATT

TCTGCTGGGTTGTGAAACTCTAGGCAGTGATGACCTTACTACCTTTAAGGTCACAGAAACCAGCACAGTGCCTGGCACAT

 

5’-3’

GGTTGGTGATCTGAGTGCCGGGTTGTTTATAAAGGACAGAAGATTCGGCAGAACTAAGCAGGCGTCAGAGGAGTTGGTGG

 

                                                 Forward primer

GTGTGAGTGCCCCTGTCCCTGCACTTCGGGTGGCTGCTGGTCCTCCGGGTCCTGCTGTGTGGTTAGACGGCTTCCGGGCA

                                                 |

                                               Biotin

 

GCCTGGTCTGGCCAGCACTCACCCTGCCCTCTCTGCCTTTTCTCCCCCAGGGTATTTGGTTTCCCAGTCCACTATACTGA

CGTCTCCAACATGAGCCGCTTGGCGAGGCAGAGACTGCTGGGCCGGTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCG

    3’-TTGTACTCGGCGAACCGA-5’-BEAD

 

    5’-AACATGAGCTGCTTGGCG CGC -> TGC; R -> C

    3’-TTGTACTCGGCAAACCGA-5’-BEAD

 

       AACATGAGCCCCTTGGCG CGC -> CCC; R -> P

    3’-TTGTACTCGGGGAACCGA-5’-BEAD

 

       AACATGAGCAGCTTGGCG CGC -> AGC; R -> S

    3’-TTGTACTCGTCGAACCGA-5’-BEAD

 

       AACATGAGCCACTTGGCG CGC -> CAC; R -> H

    3’-TTGTACTCGGTGAACCGA-5’-BEAD

 

CTCCGCTGAAGGAGTATTTTGCGTGTGTGTAAGGGACATGGGGGCAAACTGAGGTAGCGACACAAAGTTAAACAAACAAA

CAAAAAACACAAAACATAATAAAACACCAAGAACATGAGGATGGAGAGAAGTATCAGCACCCAGAAGAGAAAAAGGAATT

TAAAACAAAAACCACAGAGGCGGAAATACCGGAGGGCTTTGCCTTGCGAAAAGGGTTGGACATCATCTCCTGATTTTTCA

ATGTTATTCTTCAGTCCTATTTAAAAACAAAACCAAGCTCCCTTCCCTTCCTCCCCCTTCCCTTTTTTTTCGGTCAGACC

TTTTATTTTCTACTCTTTTCAGAGGGGTTTTCTGTTTGTTTGGGTTTTGTTTCTTGCTGTGACTGAAACAAGAAGGTTAT

           3’-GAAAAGTCTCCCCAAAAGACA-5’

                 Reverse Primer

 

TGCAGCAAAAATCAGTAACAAAAAATAGTAACAATACCTTGCAGAGGAAAGGTGGGAGAGAGGAAAAAAGGAAATTCTAT

AGAAATCTATATATTGGGTTGTTTTTTTTTTTGTTTTTTGTTTTTTTTTTTTGGGTTTTTTTTTTTACTATATATCTTTT

TTTTGTTGTCTCTAGCCTGATCAGATAGGAGCACAAGCAGGGGACGGAAAGAGAGAGACACTCAGGCGGCAGCATTCCCT

----

 

Probe Design for BNA/DNA Probes.

This table shows the uniform Tm values for the BNA-NC probes, whereas the LNA probes had slightly lower Tm values. The positions of the modified nucleotide for the BNA-NC probes are shown as well. However, since the positions for the LNA probes are propriotary informatioin, they can not be shown here.

probe design table

(Source: Shivarov et al. 2014)

The Luminex® 100 and 200™ Systems

Luminex

Luminex

The Luminex® 100 and 200™ Systems are analyzers that can perform up to 100 or 200 assays simultaneously in a single well of a microtiter plate. This system is based on the principles of flow cytometry, integrated into the xMAPR technology (multi-analyte profiling beads) enabling the detection and quantitation of multiple RNA or protein targets simultaneously. The xMAP system combines a flow cytometer, fluorescent-dyed microspheres (beads), lasers and digital signal processing to allow multiplexing of up to 100 or 200 unique assays, depending on the instruments used within a single sample. [http://www.lifetechnologies.com/us/en/home/life-science/cell-analysis/immunoassays/luminex-instruments/luminex-200-system.html]

 

References

Soo Jin Kim, Hongbo Zhao, Swanand Hardikar, Anup Kumar Singh, Margaret A. Goodell, and Taiping Chen; A DNMT3A mutation common in AML exhibits dominant-negative effects in murine ES cells. December 12, 2013; Blood: 122 (25).

Shivarov V, Ivanova M, Naumova E; Rapid Detection of DNMT3A R882 Mutations in Hematologic Malignancies Using a Novel Bead-Based Suspension Assay with BNA-NC(NC) Probes. PLoS One. 2014 Jun 10;9(6):e99769. doi: 10.1371/journal.pone.0099769. eCollection 2014.

Why Choose Bio-Synthesis

Trusted by biotech leaders worldwide for over 45 years of delivering high-quality, fast, and scalable synthetic biology solutions.