Bridged Nucleic Acid (BNA) based FISH probes are smart tools available from Biosynthesis Inc.
Recent advancements in the design and development of molecular probes and image analysis has made fluorescence in situ hybridization (FISH) a powerful tool. Although being a useful technique FISH is a fairly time-consuming procedure with limitations in sensitivity. Probes that exhibit higher DNA affinities promise to potentially improve the sensitivity of the technique. Artificial nucleotides such as bridged nucleic acids (BNAs) have been described for the development of chimeric BNA/DNA oligonucleotides as probes for fluorescence in situ hybridization on metaphase chromosomes and interphase nuclei.
BNAs at Biosynthesis Inc.
.jpg)
Call us at 1-800-227-0627 or you can visit our website at “www.biosyn.com“
Bridged nucleic acids (BNA3) are artificial bicyclic oligonucleotides that contain a six-membered bridged structure with a “fixed” C3’-endo sugar puckering. The bridge is synthetically incorporated at the 2’, 4’-position of the ribose to afford a 2’, 4’-BNA monomer. The monomers can be incorporated into oligonucleotide polymeric structures using standard phosphoamidite chemistry. BNAs are structurally rigid oligo-nucleotides with increased binding affinities and stability. Oligonucleotide modifications are characterized by the presence of one or more bicyclic ribose analogs. The structural similarity to native nucleic acids and the presence of a nitrogen atom within the bicyclic ring leads to very good solubility in water and allows for easy handling of synthetic primers and probes. In contrast to peptide nucleic acids (PNAs) and minor groove binders (MGBs), but similar to LNAs, BNA monomers can be used for both primers and probes in real time quantitative polymerase chain reaction (RT-Q-PCR) assays. Compared to locked nucleic acids (LNAs) the substitution of DNA monomers with BNA monomers in oligonucleotides adds exceptional biological stability, resistance to nucleases and a significantly increased affinity to their complementary DNA targets.
Repetitive sequence elements such as the human satellite-2 sequence can be used to design specific FISH probes. Repetitive elements comprise ~45% of the human genome and consist of interspersed repeats derived from non-autonomous or autonomous transposable elements and tandem repeats of simple sequences (satellite DNA) or complex sequences. The most abundant short interspersed nucleotide element (SINE) in human DNA is the Alu repeat, an ~282 bp non-LTR (Long Terminal Repeat) DNA sequence, which comprises 10% of the human genome and is present in ~1 million copies per haploid genome.
Other abundant non-LTR sequences are long interspersed nucleotide elements (LINEs) of up to 6 kb that comprise ~20% of the human genome. LINE-1 elements are present at over 500 000 copies in the human genome. Only 3000–4000 are full length and 30–100 are active retrotransposons.
LINE-1 elements are usually methylated in somatic tissues, and LINE-1 hypomethylation is a common characteristic of human cancers. Alu sequences are also normally methylated in somatic tissues and are thought to become hypomethylated in human cancer cells. Not all Alus are hypomethylated in human cancers. Alu sequences located upstream of the CDKN2A promoter were found to be hypermethylated in cancer cell lines, and an Alu sequence located in intron 6 of TP53 showed extensive methylation in normal and cancer cells. LINEs and SINEs are interspersed throughout the genome, whereas satellite DNA is largely confined to the centromeres or centromere-adjacent (near or close to the centromere) heterochromatin and to the large region of heterochromatin on the long arm of the Y chromosome.
Satellite a (Sata) repeats are composed of 170 bp DNA sequences and represent the main DNA component of every human centromere. Satellite 2 (Sat2) DNA sequences are found predominantly in juxtacentromeric heterochromatin of certain human chromosomes and are most abundant in the long juxtacentromeric heterochromatin region of chromosome (Chr) 1. Sat2 sequences are composed of variants of two tandem repeats of ATTCCATTCG followed by one or two copies of ATG. Both Chr1 Sata and Chr1 Sat2 sequences, as well as Sata repeats present throughout all the centromeres, are highly methylated in normal postnatal tissues, hypomethylated in sperm and often hypomethylated in various cancers (26–29). In addition, Sat2 sequences on Chr1 and Chr16 are also hypomethylated in the ICF (immunodeficiency, centromeric region instability and facial abnormalities) syndrome, which usually involves mutations in DNMT3B.
Probe design and preparation
The 23-bp human satellite-2 repeat sequence is used as an example for the design of FISH probes.
The 23-bp human satellite-2 repeat sequence, attccattcgattccattcgatc, or a 24-bp telomere sequence (ttagggttagggttagggttaggg) representing 4 blocks of the 6-bp telomere repeat (ttaggg) can be used to design and synthesize BNA/DNA mixmers with different BNA substitution patterns. All mixmer oligonucleotides can be synthesized with a Cy3, a biotin group or any other fluorescence label at the 5’ end. An unsubstituted DNA oligonucleotide probe or a scrambled BNA/DNA probe can be used as control probes.
– … –
Biosynthesis Incorporated
has 28 years experience in the analysis and synthesis of synthetic peptides, proteins, DNA and RNA oligonucleotides, bioconjugates and other biomolecules.
.
You can call us at 1-800-227-0627
or you can visit our website at
“www.biosyn.com“
.
We are here to help you with all your scientific research needs!
.