References for BNANC[NH] and [NMe] monomers
Overview of listed papers
2005: Rahman SM, Seki S, Utsuki K,Obika S, Miyashita K, Imanishi T.; Synthesis and properties of 2',4'-BNA(NC), a second generation BNA. Nucleic Acids Symp Ser (Oxf). 2005; (49):5-6.
First synthesis of 2’,4’-BNANC [NH] and [NMe]. Hybridization. Nuclease stability and Duplex-Formation RNA and DNA.
Tm Values of the 2’,4’-BNANC- Modified Oligonucleotides with Complementary ssRNA
Tm=(ΔTm /modification), (°C)oligonucleotides T= 2’,4’-BNANC
| |
[NH] |
[NMe] |
| d(GCGTTTTTTGCT) |
45 |
45 |
| d(GCGTTTTTTGCT) |
51 (+6.0) |
50 (+5.0) |
| d(GCGTTTTTTGCT) |
61 (+5.3) |
59 (+4.7) |
| d(GCGTTTTTTGCT) |
83 (+ 6.3) |
80 (+5.8) |
Conditions: 100 mM NaCl, 10 mM sodium phosphate pH 7.2. 4 µM complementary strands.
Target dsDNA: 5’-d(AGCAAAAAACGC)-3’
Conclusion:
Excellent nuclease resistance and strong hybridization ability against complementary strand
Duplex formation
2006: Rahman SM, Seki S, Utsuki K, Obika S, Miyashita K, Imanishi T.; High-affinity RNA mimicking binding of 2',4'-BNANC towards complementary strands: a comparative study with 2',4'-BNA/LNA. 2006 Nucleic Acids Symposium Series No. 50 195–196.
2',4'-BNANC duplex-forming ability towards a single-stranded RNA was similar to or slightly higher than that of 2',4'-BNA(LNA) and the overall triplex-forming ability against a double-stranded DNA was also better than that of 2',4'-BNA(LNA). 2',4'-BNANC exhibited higher RNA selectivity than 2',4'-BNA.
Tm values of both 2',4'-BNANC (N-H) and 2',4'-BNANC (N-Me) modified oligonucleotides were increased by 6 °C and 5°C, respectively, by a single modification.
These results of duplex-forming affinity is similar to that of 2',4' -BNA/LNA modified oligonucleotide.
Increasing the number of modifications from one to three, Trn values further increased and the T;n per modification (~Tm) was slightly higher than that of 2',4'-BNA/LNA.
Binding affinity against a complementary RNA strand by 2',4'-BNANC modified oligonucleotides was similar to or slightly higher than that of 2' ,4'-BNA/LNA modified oligonucleotides.
Trn values by the modified oligonucleotides indicate that 2' ,4' -BNANC modified oligonucleotides
possessed RNA selective binding affinity. 2',4' -BNANC (N-Me) modified oligonucleotides offered highest RNA selectivity amongst the modified oligonucleotides.
Tm values of 2',4'-BNANC and 2',4'-BNA/LNA modified oligonucleotides against complementary ssRNA and ssDNA
T
m (ΔT
m /modification) (°C)
Note: X, Y, Z represent modification of the natural oligonucleotide by 2',4'-BNANC (N-H), 2',4'-BNANC (N-Me) and 2',4'-BNA/LNA thymine monomers, respectively
Conditions:100 mM NaCI, 10 mM sodium phosphate buffer (pH 7.2), using 4 µM complementary strand; scan rate 0.5 °C/min (from 5 to 90 °C).
Target sequence:
5'r(AGCAAAAACGC)-3' for RNA
5'-d(AGCAAAAACGC)-3' for DNA
CONCLUSION
2',4'-BNANC monomers showed extraordinarily high binding affinity towards the complementary strands which is similar to or slightly higher than that of the corresponding oligonucleotides modified by 2',4'-BNA/LNA.
2',4'-BNANC offers a site on the bridged structure (N atom) for further functionalization e.g. with fluorescence or DNA cleavage activators. 2007: Kazuyuki Miyashita, S. M. Abdur Rahman, Sayori Seki, Satoshi Obikaab and Takeshi Imanishi; N-Methyl substituted 2’,4’-BNANC: a highly nuclease-resistant nucleic acid analogue with high-affinity RNA selective hybridization. Chem. Commun., 2007, 3765–3767.
2', 4'-BNA(NC)[N-Me] in comparison to 2',4'-BNA (LNA), have similarly
Change in melting temperature (ΔTm) of modified oligonucleotides (7–9 and 11–13) relative to the reference oligonucleotide 15, 5’-d(GCGTTTTTTGCT)-3’. The Tm values of the duplexes formed by 15 with complementary DNA and RNA were 50 and 45 °C. Tm values were obtained from the maxima of the first derivatives of the melting curves (at 260 nm).
Conditions: 4 mM strands solution in 10 mM sodium phosphate buffer (pH 7.2) containing 100 mM
NaCl.
Target sequences: DNA, 5’-d(AGCAAAAAACGC)-3’
RNA, 5’-r(AGCAAAAAACGC)-3’
2007:Rahman SM, Seki S, Utsuki K, Obika S, Miyashita K, Imanishi T .; 2',4'-BNA(NC): a novel bridged nucleic acid analogue with excellent hybridizing and nuclease resistance profiles. Nucleosides Nucleotides Nucleic Acids. 2007;26(10-12):1625-8.
Abstract: Oligonucleotides modified with 2 ',4 '-BNA(NC) (N-H)/(N-Me) monomers exhibited excellent hybridizing and nuclease resistance properties. Duplex and triplex thermal stabilities were greatly enhanced by incorporating 2',4'-BNA(NC) (N-H) and (N-Me) monomers and nuclease resistance was tremendously higher than that of natural oligonucleotide.
UV melting temperatures (Tm)Values of the 2’,4’-BNANC- Modified Oligonucleotides with Complementary ssRNA (Duplex Formation{DF}) and Triplex Formation (TFO)
(X = 2’,4’-BNANC (N-H) thymine and Y = 2’,4’-BNANC (N-Me) thymine monomers, respectively; mC=
5-methylcytidine) . Conditions: 100 mM NaCl, 10 mM sodium phosphate pH 7.2. 4 µM complementary strands.
Target strands used for duplex and triplex forming experiments were
RNA: 5_-r(AGCAAAAACGC)-3
DNA: 5_-d(GCTAAAAAGAAAGAGAGATCG)-3
DNA: 3_-d(CGATTTTTCTTTCTCTCTAGC)-5
CONCLUSION
2’,4’-BNANC (N-H) and (NMe) greatly enhance duplex and triplex stability against ssRNA and dsDNA.
The Nuclease resistance property of both 2’,4’-BNANC (N-H) and (N-Me) modified oligonucleotides was very much higher than that of natural oligonucleotide.
2’4’-BNANC (N-H) analogue offers a site (N-atom) on the bridged structure for further functionalization with various functional moieties (such as florescence, DNA cleavage activator) which would provide versatile applications in genomics.
2007: S. M. Abdur Rahman, Sayori Seki, Satoshi Obika, Sunao Haitani, Kazuyuki Miyashita, and Takeshi Imanishi; Highly Stable Pyrimidine-Motif Triplex Formation at Physiological pH Values by a Bridged Nucleic Acid Analogue. Angew. Chem. Int. Ed. 2007, 46, 4306 –4309.
Tm values of triplexes containing 2,4,-BNANC[NH] (bold red), 2’,4’-BNA(LNA) (bold blue), and ENA (bold black).[a,b]
[a]
Target duplex: 5’-d(GCT
AAAAAGAAAGAGAGATCG)-3’/ 3’-d(CGATTTTTCTTTCTCTCTAGC)-5’ ;
underlined portion indicates the target site for triplex formation.
[b] Conditions: 7 mm Na2HPO4 buffer solution containing 140 mm KCl; strand concentration=1.5 mm; scan rate 0.5 °C/min. Tm = melting temperatures, ΔTm = changes in melting temperature, ΔTm/mod=changes in melting temperature per single modification; mC = 5-methylcytidine.
Conclusion: TFOs composed of 2’,4’-BNANC forms highly stable pyrimidine-motif triplexes at physiological pH values.
Triplex-forming ability is higher than that of 2’,4’-BNA/LNA- and ENA-modified TFOs.
These TFOs eliminate the requirement of placing alternating DNA monomers for optimum efficacy.
2007: Satoshi Obika, Masaharu Tomizu, Yoshinori Negoro, Ayako Orita, Osamu Nakagawa, and Takeshi Imanishi; Double-Stranded DNA-Templated Oligonucleotide Digestion Triggered by Triplex Formation. ChemBioChem 2007, 8, 1924 – 1928. Note: Triplex triggered cleavage of oligonucleotides.
Bond cleavage reactions promoted by hybridization with DNA templates comprise a new class of DNA-templated organic synthesis (DTS) and should be useful for novel DNA sensing technologies.
Oligonucleotides with P3’->N5’ phosphoramidate linkages can be cleaved at the phosphoramidate bond under mild acidic conditions.
dsDNA sensing probes
Effect of triplex formation on cleavage of oligonucleotides 1–3.[a]
5’-d(TTTTTCTXTCTCTCT)-3’
oligonucleotide 1 [X= 5’-amino-DNA-T]
oligonucleotide 2 [X = 5’-amino-2’4’-BNA-T(R = H)]
oligonucleotide 3 [X = 5’-amino-3’,5’-BNA-T]
oligonucleotide 4 [X = 5’-amino-2’4’-BNA-T(R = Me)]
5’-d(GCTAAAAAGAYAGAGAGATCG)-3’
5’-d(CGATTTTTCTZTCTCTCTAGC)-3’
dsDNA target (perfect match) 5 [YZ = AT]
dsDNA target (mis match) 6 [YZ = TA], 7 [YZ = GC], 8 [YZ = CG]
C = 2’-deoxy-5-methylcytidine
[a] Oligonucleotides 1–3 were treated at pH 3 for the indicated time period in the presence or absence of a
perfectly matched dsDNA target, 5. The percentage of remaining intact oligonucleotide was determined by
HPLC.
dsDNA sensing by the acid-mediated phosphoramidate cleavage (APAC) probes.
A) Sequences of the APAC probes and the dsDNA targets. F, TAMRA-dT; Q, BHQ-2-dT; C, 2’-deoxy-5-methylcytidine; and X, 5’-amino-2’,4’-BNA-T (R=Me).
B) Emission spectra of the APAC probe A in the absence (left) or presence (right) of the fully matched dsDNA target A. APAC probe A was incubated in an acidic buffer (pH 4) at 408C. After 0 (red), 10 (green), 30 (blue), and 60 min (yellow), the reaction mixture was neutralized and the emission spectrum was measured with excitation at 545 nm.
C) Images of the fluorescence of APAC probes A–C in the presence or absence of the dsDNA targets. The samples were incubated for 10 min at pH 4.0 and 408C, neutralized, and photographed.
2008: Masayasu Kuwahara, Satoshi Obika, Jun-ichi Nagashima, Yuki Ohta, Yoshiyuki Suto, Hiroaki Ozaki, Hiroaki Sawai and Takeshi Imanishi; Systematic analysis of enzymatic DNA polymerization using oligo-DNA templates and triphosphate analogs involving 2’,4’-bridged nucleosides. Nucleic Acids Research, 2008, Vol. 36, No. 13 4257–4265.
SELEX, DNA Aptamer, DNAzymes
Five types of thermostable DNA polymerases used Taq, Phusion HF, Vent(exo-), KOD Dash and
KOD(exo-), the KOD Dash and KOD(exo-) DNA polymerases could smoothly read through the modified templates containing 2’-O,4’-C-methylene-linked nucleotides at intervals of a few nucleotides, even at standard enzyme concentrations for 5 min.
KOD(exo-) DNA polymerase was found to be far superior to the Vent(exo-) DNA polymerase in accurate incorporation of nucleotides.
Successive incorporation of 2’,4’-bridged nucleotides into extending strands using 2’,4’-bridged nucleoside-5’-triphospates was much more difficult.
These data indicate that the sugar modification would have a greater effect on the polymerase reaction when it is adjacent to the elongation terminus than when it is on the template as well, as in base modification.
CONCLUSION
KOD Dash DNA polymerase is suitable for enzymatic production of modified DNA containing base-modified nucleotides.
Using this DNA polymerase, we prepared a modified DNA library involving C5-modified thymidine and successfully screened modified DNA aptamers bound to sialyllactose, R-isomer of thalidomide derivative, and so on by SELEX.
Thus, KOD Dash DNA polymerase could accept a broad range of nucleotide modifications and might be best suited for enzymatic preparation of functional modified DNA.
The BNA templates containing sequences of seven successive 2’,4’-bridged nucleotides Ks, Ls and Ms could not be completely transcribed by any DNA polymerases used; yields of longer elongated products decreased in the order of steric bulkiness of the modified sugars.
Successive incorporation of bridged nucleotides into extending strands using triphosphates KTP (LNA), LTP(O-.-O) and MTP(BNANC[NH]) were much more difficult.
KOD Dash and KOD(exo-) DNA polymerases could smoothly read through the BNA templates containing Ks or KAs at intervals of three nucleotides, two nucleotides and one nucleotide, respectively, and produce the corresponding complimentary natural DNA strand even under standard enzyme concentrations.
Vent(exo-) DNA polymerase also read through these BNA templates; however, kinetic study indicates that KOD(exo-) was found to be far superior to Vent(exo-) in accurate incorporation of nucleotides.
2008: Satoshi Obika, S. M. Abdur Rahman, Bingbing Song, Mayumi Onoda, Makoto Koizumi, Koji Morita, Takeshi Imanishi; Synthesis and properties of 3’-amino-2’,4’-BNA, a bridged nucleic acid with a N3’->P5’ phosphoramidate linkage. Bioorganic & Medicinal Chemistry 16 (2008) 9230–9237.
Oligonucleotides containing the 3’-amino-2’,4’-BNA residue form highly stable duplexes and triplexes with single-stranded DNA (ssDNA), single-stranded RNA (ssRNA), and double-stranded DNA (dsDNA) targets, with the average increase in melting temperature (Tm) against ssDNA, ssRNA and dsDNA being +2.7 to +4.0 °C, +5.0 to +7.0 °C, and +5.0 to +11.0 °C.
Comparable to LNAs.
Oligonucleotide modified with a single 3’-amino-2’,4’-BNA thymine residue showed extraordinarily high resistance to nuclease degradation, much higher than that of LNAs and substantially higher even than that of 3’-amino-DNA and phosphorothioate oligonucleotides.
Duplex Formation
Tm values of duplexes formed by 3’-amino-2’,4’-BNA oligonucleotides with ssDNA and ssRNA a,b
T
m (ΔT
m /modification) (°C) _________________________
a Targets:
ssDNA, 5’-d(AGCAAAAAACGC)-3’;
ssRNA, 5’-r(AGCAAAAAACGC)-3’ .
b Conditions: 10 mM sodium phosphate buffer (pH 7.2) containing 100 mM NaCl;
strand concentration = 4 µM. T = 3’-amino-2’,4’-BNA-T, t = 2’,4’-BNA-T (LNA).
c Data from Obika et al., 2003. d Data from Imanishi and Obika, 1999.
Duplex thermal stability further improved upon increasing the number of modifications.
Incorporating three 3’-amino-2’,4’-BNA residues either consecutively or separated by natural DNA units resulted in duplexes with very high thermal stability.
The most prominent enhancement in thermal stability was observed in duplexes formed with complementary ssRNA.
A modified oligonucleotide containing six consecutive 3’-amino-2’,4’-BNA residues also formed duplexes with ssRNA and ssDNA with remarkably improved thermal stability.
Triplex Formation
Tm values of triplexes formed by 3’-amino-2’,4’-BNA oligonucleotides with dsDNA a,b
Conditions: 7 mM sodium phosphate buffer (pH 7.0) containing 140 mM KCl in the absence or the presence of MgCl2 (10 mM); strand concentration = 1.5 µM. T = 3’-amino-2’,4’-BNA-T, mC = 3’-amino-2’,4’-BNA-mC, t = 2’,4’-BNA-T, mc = 2’,4’-BNA-mC.
Sequence specific triplex by 3’-amino-2’,4’-BNA modified TFO a
| _________________________________________________________________________________ |
| TmTm (ΔTm – Tm(mismatch) – Tm (match)) (°C) |
_____________________________________________________________
| Oligonucleotides, 5’ to 3’ |
X:Y =A:T |
(match) |
G:C |
C:G |
T:A |
| TTTTTmCTTTmCTmCTmCT |
d(GCTAAAAAGAXAAAGAGATCG)
d(CGATTTTTCYTTCTCTCTAGC) |
44 |
20(-24) |
25(-19) |
17(-25) |
| TTTTTmCTTTmCTmCTmCT |
d(GCTAAAAAGAXAAAGAGATCG)
d(CGATTTTTCYTTCTCTCTAGC) |
55 |
31(-24) |
32 (-23) |
16 (-39) |
| TTTTTmCTtTmCTmCTmCT |
d(GCTAAAAAGAXAAAGAGATCG)
d(CGATTTTTCYTTCTCTCTAGC) |
57 |
31 (-26) |
35 (-22) |
16 (-41) |
|
T = 3’-Amino-2’,4’-BNA; t = LNA
a Conditions: 7 mM sodium phosphate buffer (pH 7.0) containing 140 mM KCl and 10 mM MgCl2; strand concentration = 1.5 µM.
Conclusion:
3’-amino-2’,4’-BNA oligonucleotides show better RNA selective binding affinity than LNA oligos.
Mismatch discrimination of 3’-amino-2’,4’-BNA is similar to that of LNA.
Nuclease resistance of 3’-amino-2’,4’-BNA is excellent. Much higher than that of natural and LNA oligonucleotides, and substantially higher even than that of 3’-amino-DNA and phosphorothioate oligonucleotides.
Useful for antisense and antigene applications.
2008: S. M. Abdur Rahman, Sayori Seki, Satoshi Obika, Haruhisa Yoshikawa, Kazuyuki Miyashita, and Takeshi Imanishi; Design, Synthesis, and Properties of 2’,4’-BNANC: A Bridged Nucleic Acid Analogue. J. AM. CHEM. SOC. 2008, 130, 4886-4896.
Very high target affinity
BNANC[NMe] has high RNA affinity and better RNA selectivity than LNA
BNANC[NH] has enhanced triplex formation ability
Fully modified BNANC[NH] oligonucleotide forms stable triplex at neutral pH.
BNANC[NH] oligonucleotide has dramatically improved resistance to nuclease degradation.
Antisense applications
BNANC[NH] oligonucleotide very good for antigene applications
2008: Sasaki K, Rahman SM, Obika S, Imanishi T, Torigoe H.; Promotion of triplex formation by 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNA NC) modification. Nucleic acids symposium series (2004) : 52 2008 pg 419-20.
Abstract: We examined the effect of 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNA(NC)) backbone modification of triplex-forming oligonucleotide (TFO) on the pyrimidine motif triplex formation at neutral pH, a condition where pyrimidine motif triplexes are unstable. The melting temperature of the pyrimidine motif triplex at pH 6.8 with 2',4'-BNA(NC) modified TFO was significantly higher than that observed with unmodified TFO. The 2',4'-BNA(NC) modification of TFO increased the thermal stability of the pyrimidine motif triplex at neutral pH. The present results certainly support the idea that the 2',4'-BNA(NC) backbone modification of TFO could be a key chemical modification and may eventually lead to progress in therapeutic applications of the antigene strategy in vivo.
BNANC[NH] forms TFOs.
2010: Yuuya Kasahara, Shunsuke Kitadume, Kunihiko Morihiro, Masayasu Kuwahara, Hiroaki Ozaki, Hiroaki Sawai, Takeshi Imanishi, Satoshi Obika; Effect of 3’-end capping of aptamer with various 2’,4’-bridged nucleotides: Enzymatic post-modification toward a practical use of polyclonal aptamers. Bioorganic & Medicinal Chemistry Letters 20 (2010) 1626–1629.
The capping of the 3′-ends of thrombin binding aptamers (TBAs) with bridged nucleotides increased the nuclease resistances and the stabilities in human serum. The binding abilities of the aptamers were not affected by the capping. The capping could be simply executed via a one step enzymatic process using 2′,4′-bridged nucleoside 5′-triphosphate and terminal deoxynucleotidyl transferase.
2010: S. M. Abdur Rahman, Hiroyuki Sato, Naoto Tsuda, Sunao Haitani, Keisuke Narukawa, Takeshi Imanishi, Satoshi Obika; RNA interference with 2’,4’-bridged nucleic acid analogues. Bioorganic & Medicinal Chemistry 18 (2010) 3474–3480.
siRNA to inhibit firefly luciferase expression in CHO-luc cells.
2011: Torigoe H,Rahman SM, Takuma H, Sato N, Imanishi T, Obika S, 2'-O,4'-C-aminomethylene-bridged nucleic acid modification with enhancement of nuclease resistance promotes pyrimidine motif triplex nucleic acid formation at physiological pH.Chemistry (Weinheim an der Bergstrasse, Germany) 17:9 2011 Feb 25 pg 2742-51.
Abstract: Due to the instability of pyrimidine motif triplex DNA at physiological pH, triplex stabilization at physiological pH is crucial in improving its potential in various triplex-formation-based strategies in vivo, such as gene expression regulation, genomic DNA mapping, and gene-targeted mutagenesis. To this end, we investigated the thermodynamic and kinetic effects of our previously reported chemical modification, 2'-O,4'-C-aminomethylene-bridged nucleic acid (2',4'-BNA(NC)) modification of triplex-forming oligonucleotide (TFO), on triplex formation at physiological pH. The thermodynamic analyses indicated that the 2',4'-BNA(NC) modification of TFO increased the binding constant of the triplex formation at physiological pH by more than 10-fold. The number and position of the 2',4'-BNA(NC) modification in TFO did not significantly affect the magnitude of the increase in the binding constant. The consideration of the observed thermodynamic parameters suggested that the increased rigidity and the increased degree of hydration of the 2',4'-BNA(NC)-modified TFO in the free state relative to the unmodified TFO may enable the significant increase in the binding constant. Kinetic data demonstrated that the observed increase in the binding constant by the 2',4'-BNA(NC) modification resulted mainly from the considerable decrease in the dissociation rate constant. The TFO stability in human serum showed that the 2',4'-BNA(NC) modification significantly increased the nuclease resistance of TFO. Our results support the idea that the 2',4'-BNA(NC) modification of TFO could be a key chemical modification to achieve higher binding affinity and higher nuclease resistance in the triplex formation under physiological conditions, and may lead to progress in various triplex-formation-based strategies in vivo.
BNANC[NH] froms TFOs
2011: Tsuyoshi Yamamoto, Moeka Nakatani, Keisuke Narukawa & Satoshi Obika; Antisense drug discovery and development Future Med. Chem. (2011) 3(3), 339–365. Overview including BNANCs.
Antisense drug discovery
Antisense drug development
Antisense medicinal chemistry
Antisense in clinical trial
Translational arrest: oligonucleotide (ON); mRNA degradation: RNase H recruitment; Splice switching: Splice switching oligonucleotide (SSO)
2012: Tsuyoshi Yamamoto, Mariko Harada-Shiba, Moeka Nakatani, Shunsuke Wada, Hidenori Yasuhara, Keisuke Narukawa, Kiyomi Sasaki, Masa-Aki Shibata, Hidetaka Torigoe, Tetsuji Yamaoka, Takeshi Imanishi and Satoshi Obika; Cholesterol-lowering Action of BNA-based Antisense Oligonucleotides Targeting PCSK9 in Atherogenic Diet-induced Hypercholesterolemic Mice Molecular Therapy–Nucleic Acids (2012) 1, e22; oi:10.1038/mtna.2012.16.
BNA-based antisense therapeutics can be used to successfully inhibit hepatic PCSK9 expression which resulted in a strong reduction of the serum LDL-C levels of mice.
PCSK9 is a potential therapeutic target for hypercholesterolemia.
BNA-based antisense oligo-nucleotides (AONs) induced a cholesterol-lowering action in hypercholesterolemic mice.