CpG oligonucleotides (CpG ODNs or CpG) are short single-stranded DNA oligonucleotides containing a cytosine guanine (CpG) motif within their sequence. The “p” in this motif refers to the phosphodiester group linking the two nucleotides.
Oligonucleotides containing unmethylated CpG motifs act as immunostimulants for the innate immune system. Immune-stimulating oligonucleotides (ISOs) activate or stimulate the innate immune system via their interaction with pattern recognition receptors, encode immunostimulatory proteins or peptides, or silence specific genes to block negative regulators of the immune system. Several specific nucleic acids and oligonucleotides can act as immunostimulants.
During viral detection, cellular antiviral defenses sense foreign nucleic acids among abundant self-nucleic acids. This mechanism is known as “immune sensing.” However, an effective antiviral defense requires a balanced process of sensing foreign nucleic acids and ignoring self-nucleic acids.
This balance is accomplished by a multilevel system combining the immune sensing of pathogen-specific nucleic acid structures with specific labeling of self-nucleic acids and nuclease-mediated degradation.
Sensing nucleic acids released from pathogens and damaged or malignant cells is the primary mechanism by which innate immune cells recognize “foreign” substances and activate signaling pathways to initiate their antimicrobial and proinflammatory functions.
In the endolysosomal compartmenrt, TLR9 preferentially recognizes unmethylated CpG regions and, when stimulated, activates B cells and human plasmacytoid dendritic cells. The activation results in a potent T helper-1 (Th1)-type immune response and an antitumor response in mouse tumor models and patients. Mammals mainly express TLR9 in subsets of Dendritic Cells and B cells. TLR9 receptors recognize different CpG motifs. Optimal sequences are GTCGTT and GACGTT for human TLR9.
Unmethylated CpG DNA containing CpG-dinucleotides is more common in bacterial genomes than in vertebrate genomes. Methylation at the CG sites generally inhibits the activity of CpG dinucleotides. The CpG motif stimulates immune cells via the toll-like receptor 9 signaling pathway.
Classes of CpG oligonucleotides and their effects (wiki/CpG_ODNs)

Krieg et al., in 1995, iteratively determined that the immunostimulatory activity of DNA sequences is restricted to a stretch of 12 to 20 base pairs containing CpG dinucleotides with selective flanking bases with the motif 5′-Pu-Pu-CpG-Pyr-Pyr-3′ as being biologically active.
Bauer et al., in 1999, when studying the effect of CpG oligonucleotides, observed that bacterial DNA and CpG ODN induce proliferation of B cells. However, other subpopulations, such as monocytes and T cells, did not increase. This study demonstrated the adjuvant-like effect in human monocytes. Bauer et al. selected the three CpG ODNs for the study listed in table 1.
Table 1: CpG oligonucleotides.
| Motif | 5′-Pu-Pu-CpG-Pyr-Pyr-3′ | | Immunostimulatory activity |
| Active Motif | AACGTT | | |
| 2006 | TCGTCGTTTTGTCGTTTTGTCGTT | | Very active! |
| 2006K | TGCTGCTTTTGTGCTTTTGTGCTT | Control | |
| DSP30 | TCGTCGCTGTCTCCGCTTCTTCTTGCC | | Very active! |
| DSP30K | TGCTGCCTGTCTCCCCTTCTTCTTGCC | Control | |
| 1668 | TCCATGACGTTCCTGATGCT | | Not very active! |
| 1669K | TCCATGAGCTTCCTGATCCT | Control | |
Hartmann et al., in 2000, tested over 250 phosphorothioate ODN for their capacity to stimulate proliferation and CD86 expression of human B cells and induce lytic activity and CD69 expression of human NK cells. These studies showed that the sequence, number, and spacing of individual CpG motifs contribute to the immunostimulatory activity of a CpG phosphorothioate ODN. An ODN with a TpC dinucleotide at the 5′-end followed by three 6mer CpG motifs (5′-GTCGTT-3′) and separated by TpT dinucleotides consistently showed the highest activity for human, chimpanzee, and rhesus monkey leukocytes.
Vaccination of chimpanzees or monkeys against hepatitis B with this CpG ODN adjuvant developed 15 times higher anti-hepatitis B Ab titers than those receiving the vaccine alone.
Oligonucleotides having the optimal murine CpG motif (5′-GACGTT-3′) are excellent immune adjuvants in various murine disease models and drive Th1 immune responses.
The study identified a high activity motif in which a 5′-TpC directly precedes a 6-mer human CpG motif (5′-TCGTCGTT-3′) followed by two 6-mer motifs (ODN 2005, ODN 2006, and ODN 2007). Best results are obtained when 6-mer CpG motifs are separated from each other and from the 5′ 8-mer CpG motif by TpT (ODN 2006).
Table 2: Oligonucleotides used to identify an optimal CpG motif (Hartman et al. 2000).
| CpG ODN | 5’---------------------3’ | |
| | Not active | |
| 1781 | ACCATGGACGTTCTGTTTCCCCTC | |
| 1823 | GCATGACGTTGAGCT | |
| 1829 | ATGACGTTCCTGACGTT | |
| | Intermediate activity | |
| 1840 | TCCATGTCGTTCCTGTCGTT | |
| 1851 | TCCTGACGTTCCTGACGTT | |
| | Highly active | |
| Motif | TCGTCGTT | |
| 2005 | TCGTCGTTGTCGTTGTCGTT | |
| 2006 | TCGTCGTTTTGTCGTTTTGTCGTT | Most immunogenic |
| 2007 | TCGTCGTTGTCGTTTTGTCGTT | |
| 2008 | GCGTGCGTTGTCGTTGTCGTT | |
| | Other CpGs studied | |
| 1982 | TCCAGGACTTCTCTCAGGTT | |
| 1983 | TTTTTTTTTTTTTTTTTTTT | |
| 1628 | GGGGTCAACGTTGAGGGGGG | |
| 1758 | TCTCCCAGCGTGCGCCAT | |
| 1760 | ATAATCGACGTTCAAGCAAG | |
| 1826 | TCCATGACGTTCCTGACGTT | |
| 1841 | TCCATAGCGTTCCTAGCGTT | |
Jahrsdörfer & Weiner, in 2008, reviewed the mechanisms by which CpG ODN may contribute to cancer immunotherapy. In this review, the scientists suggested that immunologic effects of immunostimulatory CpG ODNs can lead directly to activation-induced cell death of TLR9 positive B cell malignancies.
Table 3: Types of CpG ODNs (Adapted from Chen et al. 2021)
| CpG Type | Typical Sequence | Structural Feature | Immunomodulatory Activity |
| Type A | GGGGGACGATCGTCGGGGG | Poly-G sequence stretch at the 3ʹ and/or 5ʹ ends. The CpG flanking region forms a palindrome. A partially PS-modified backbone. GC dinucleotides are contained within phosphodiester backbone. | Strongly induce pDCs to secrete IFN-α. Promote APC maturation. Almost no effect on activation of B cells. |
| Type B | TCGTCGTTTTGTCGTTTTGTCGTT | A full PS linearized backbone. One or more CpG motifs. | Strongly induce B cell proliferation and pDC maturation. Weakly induce pDCs to secrete IFN-α. |
| Type C | TCGTCGTTCGAACGACGTTGAT | A full PS backbone. CpG-containing palindromic motif. | Strongly induce pDCs to secrete IFN-α. Induce the activation and proliferation of B cells. |
Notes: CpG motifs are highlighted in green. Bold letters in CpG ODN sequences indicate self-complementary palindromes. Italic indicate PS links.
Abbreviations: CpG, cytosine-phosphate-guanine; poly-G, poly-guanosine; PS, phosphorothioate; pDCs, plasmacytoid dendritic cells; IFN-α, interferon-α; APC, antigen-presenting cell; ODN, oligodeoxyribonucleotide.
CpG-A ODNs: Synthetic CpG ODNs contain PO central CpG-containing palindromic motifs and a 3’ poly-G string modified with phosphorothioates (PS). CpG-A ODNs induce a high IFN-α production from pDCs but are weak stimulators of TLR9-dependent NF-κB signaling and pro-inflammatory cytokine (e.g. IL-6) production.
CpG-B ODNs: Synthetic CpG-B ODNs contain a PS backbone with one or more CpG dinucleotides. They strongly activate B cells and TLR9-dependent NF-κB signaling but weakly stimulate IFN-α secretion.
CpG-C ODNs: Synthetic CpG-C ODNs have combined features of classes A and B. They contain a complete PS backbone and a CpG-containing palindromic motif. C-Class CpG ODNs induce strong IFN-α production from pDC and B cell stimulation.
The diverse functions of nucleic acids and oligonucleotides are critical components in vaccine development and cancer immunotherapy. For example, vaccination of the mucous membranes, the inner lining tissue cells of the nose, mouth, lungs, and stomach can initiate enhanced systemic and mucosal humoral and cellular immune responses, resulting in protection against pathogens, even at a different mucosal site. Also, combining CpG ODNs with radiation and chemotherapy can be effective. For example, treating tumors with CpG ODNs combined with radiation and docetaxel enhances the response and improves the cure rate of murine tumors.
Unfortunately, the instability, poor pharmacokinetics profile, non-specific biodistribution, and difficulty in accessing intracellular targets of CpG oligonucleotides make it challenging to develop CpG oligonucleotide-based therapeutics.
CpG 1018 is an adjuvant used in Heplisav-B vaccine made up of CpG motifs. When CpG 1018 is included in vaccines, it increases the body’s immune response.
Liu et al., in 2023, reported that CpG 684 can enhance IgG, IgG2b, and IgM binding antibodies and also change the ratio between IgG1 and IgG2a binding antibodies in response to the inactivated COVID-19 vaccine. CpG 684 can alter the immune response from Th2 to Th1 and enhance the neutralizing antibody titers of the inactivated COVID-19 vaccine against prototype, Delta, and Beta strains. As a result, CpG 684 is an effective adjuvant for the inactivated COVID-19 vaccine.
Reference
Bauer M., Heeg K., Wagner H. DNA activates human immune cells through a CpG sequence-dependent manner. Immunology. 1999;97:699–705. [PMC]
CpC 1018 CDC info
Chen W, Jiang M, Yu W, Xu Z, Liu X, Jia Q, Guan X, Zhang W. CpG-Based Nanovaccines for Cancer Immunotherapy. Int J Nanomedicine. 2021 Aug 5;16:5281-5299. [PMC]
CpG oligonucleotides.
Hartmann G, Weeratna RD, Ballas ZK, Payette P, Blackwell S, Suparto I, Rasmussen WL, Waldschmidt M, Sajuthi D, Purcell RH, Davis HL, Krieg AM (February 2000). "Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo". Journal of Immunology. 164 (3): 1617–24.
Jahrsdörfer B, Weiner GJ. CpG oligodeoxynucleotides as immunotherapy in cancer. Update Cancer Ther. 2008 Mar;3(1):27-32. [PMC]
Krieg AM, Yi AK, Matson S, et al. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 1995;374:546. [PubMed]
Lin Y-X, Wang Y, Blake S, Yu M, Mei L, Wang H, Shi J, RNA Nanotechnology-Mediated Cancer Immunotherapy, Theranostics, 10 (2020) 281–299. [PMC]
Liu J, Cang T, Jiang C, Li K, Liu S, Wang H, Wang M, Chen Y, Shao Y, Liu J. CpG 684: an effective adjuvant for the inactivated COVID-19 vaccine in mice. Future Virol. 2023 May;18(7):403-410. [PMC]
Meng F, Wang J, Yeo Y. Nucleic acid and oligonucleotide delivery for activating innate immunity in cancer immunotherapy. J Control Release. 2022 May;345:586-600. [PMC]
Schlee M, Hartmann G, Discriminating self from non-self in nucleic acid sensing, Nature Reviews Immunology, 16 (2016) 566–580. [PMC]
Shen T, Zhang Y, Zhou S, Lin S, Zhang X-B, Zhu G, Nucleic Acid Immunotherapeutics for Cancer, ACS Appl Bio Mater, 3 (2020) 2838–2849. [PMC]
Weiner GJ, Liu HM, Wooldridge JE, Dahle CE, Krieg AM. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc Natl Acad Sci U S A. 1997 Sep 30;94(20):10833-7. [PMC]
---…---