Live Chat Support Software
800.227.0627

Synthetic RNA Controls

High-throughput sequencing of cDNA (RNA-seq) is a widely used method that allows for transcriptome profiling and annotation. However, questions about the accuracy and performance of different protocols and platforms remain. To address this issues, synthetic RNA controls can be used as spike-in controls. Jiang et al. in 2011 reported the use of a pool of 96 synthetic RNAs with various lengths, and GC content covering a 220 concentration range as synthetic RNA spike-in controls to measure sensitivity, accuracy, and biases in RNA-sequencing experiments. The standard curves for quantifying the abundance of transcripts were also derived. The linearity between read density and RNA input over the entire detection range was observed as well as excellent agreement between replicates. However, the researchers observed a significantly larger imprecision than expected under pure Poisson sampling errors.

In summary, synthetic RNA controls are very useful to allow the evaluation of reproducibilities of RNA-based assay protocols. Ussing synthetic RNA controls allows to determine biases due to GC content, transcript length, and heterogeneities in coverage across transcripts. In addition, synthetic RNA controls can help establishing the limits for RNA-sequencing discovery experiments. Furthermore, synthetic RNA controls, when used externally, allow evaluation of the sensitivity and accuracy of RNA-sequencing based transcriptome analysis.  {Jiang et al., 2011; Genomic Research 21:1543-1551}

The following is a list of synthetic constructs used for the experiment derived from the genbank.


Results of BLASTN 2.2.23+ Query for the constructs:

Query=  ERCC-00002_genbank |92111308|gb|DQ459430.1|

Synthetic construct microarray control MC28 mRNA, complete sequence

Length=1134, Subject=  ERCC-00002, Length=1061
Score = 1919 bits (1039),  Expect = 0.0
Identities = 1055/1062 (99%), Gaps = 3/1062 (0%)
Strand=Plus/Plus

Query  69    TCCAGATTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGAC  128
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1     TCCAGATTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGAC  60

Query  129   CGTCGGCTGATCGTAGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATT  188
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61    CGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATT  120

Query  189   CCTGGAGGAATAGGTACCAAGaaaaaaaCGAACCTTTGGGTTCCAGAGCTGTACGGTCGC  248
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121   CCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGC  180

Query  249   ACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCA  308
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181   ACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCA  240

Query  309   CAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGG  368
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241   CAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGG  300

Query  369   AAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGA  428
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  301   AAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGA  360

Query  429   GGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCA  488
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361   GGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCA  420

Query  489   ATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGT  548
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  421   ATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGT  480

Query  549   TGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGAATTATTAACTGCGCAGTTAGGGC  608
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  481   TGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGAATTATTAACTGCGCAGTTAGGGC  540

Query  609   AGCGTCTGCGGAAGTTTGCTGCGGTTTCCGCCTTGACCGCGGGAAGGAGACATAACGATA  668
             |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct  541   AGCGTCTGAGGAAGTTTGCTGCGGTTTC-GCCTTGACCGCGGGAAGGAGACATAACGATA  599

Query  669   GCGACTCTGTCTCAGCGGATCTGCATATGTTTGCAGCATACTTTAG-TGGGCCTTGGCTT  727
             ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||
Sbjct  600   GCGACTCTGTCTCAGGGGATCTGCATATGTTTGCAGCATACTTTAGGTGGGCCTTGGCTT  659

Query  728   CCTTCCGCAGTCAAAACCGCGCAATTATCCCCGTCCTGATTTACTGGACTCGCAACGTGG  787
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  660   CCTTCCGCAGTCAAAACCGCGCAATTATCCCCGTCCTGATTTACTGGACTCGCAACGTGG  719

Query  788   GTCCATCAGTTGTCCGTATACCAAGACGTCTAAGGGCGGTGTACACCCTTTTGAGCAATG  847
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  720   GTCCATCAGTTGTCCGTATACCAAGACGTCTAAGGGCGGTGTACACCCTTTTGAGCAATG  779

Query  848   ATTGCACAACCTGCGATCACCTTATACAGAATTATCAATCAAGCTCCCCGAGGAGCGGAC  907
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  780   ATTGCACAACCTGCGATCACCTTATACAGAATTATCAATCAAGCTCCCCGAGGAGCGGAC  839

Query  908   TTGTAAGGACCGCTGCTTTCGCTCGGGTCTGCGGGTTATAGCTTTTCAGTC-CGACGGGC  966
             ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct  840   TTGTAAGGACCGCCGCTTTCGCTCGGGTCTGCGGGTTATAGCTTTTCAGTCTCGACGGGC  899

Query  967   TAGCACACATCTGGTTGACTAGGCGCATAGTCGCCATTCACAGATTTGCTCGGCAATCAG  1026
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  900   TAGCACACATCTGGTTGACTAGGCGCATAGTCGCCATTCACAGATTTGCTCGGCAATCAG  959

Query  1027  TACTGGTAGGCGTTAGACCCCGTGACTCGTGGCTGAACGGCCGTACAACTCGACAGCCGG  1086
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  960   TACTGGTAGGCGTTAGACCCCGTGACTCGTGGCTGAACGGCCGTACAACTCGACAGCCGG  1019

Query  1087  TGCTTGCGTTTTACCCTTaaaaaaaaaaaaaaaaaaaaaaaa  1128
             ||||||||||||||||||||||||||||||||||||||||||
Sbjct  1020  TGCTTGCGTTTTACCCTTAAAAAAAAAAAAAAAAAAAAAAAA  1061


Query=  ERCC-00003_genbank |103488731|gb|DQ516784.1|
Methanocaldococcus jannaschii spike-in control MJ-1000-67 genomic sequence
Length=1000 
Subject=  ERCC-00003 Length=1023
Score = 1840 bits (996),  Expect = 0.0
Identities = 999/1000 (99%), Gaps = 1/1000 (0%)
Strand=Plus/Plus

Query  1    CAGCAGCGATTAAGGCAGAGGCGTTTGTATCTGCCATTATAAAGAAGTTTCCTCCAGCAA  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1    CAGCAGCGATTAAGGCAGAGGCGTTTGTATCTGCCATTATAAAGAAGTTTCCTCCAGCAA  60

Query  61   CTCCTTTCTTAATTCCAAACTTAGCTTCAGTTATAAATTCCCCTCCCATGATTGGGATTT  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61   CTCCTTTCTTAATTCCAAACTTAGCTTCAGTTATAAATTCCCCTCCCATGATTGGGATTT  120

Query  121  TATAAACTTTTCTTCCATATAATTCATCTTTCTTCTCATAACCGTCTCCGAAAAACTTCA  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121  TATAAACTTTTCTTCCATATAATTCATCTTTCTTCTCATAACCGTCTCCGAAAAACTTCA  180

Query  181  ACTTAAATCCAACCTTTAACTGCTCATCAGCCATGTCTCCCATAGCATCAAAAATAGCAG  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181  ACTTAAATCCAACCTTTAACTGCTCATCAGCCATGTCTCCCATAGCATCAAAAATAGCAG  240

Query  241  TTGTTGGACATGTTAAGACACACTGCCCCAATCTCTCTAACATTTGATGCTCTAACTCTG  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241  TTGTTGGACATGTTAAGACACACTGCCCCAATCTCTCTAACATTTGATGCTCTAACTCTG  300

Query  301  ACTTTTTAGGGTGGCATATCTGTATTATAAATCCTGGTCTTCCATCTGGTGTTTTTGATG  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  301  ACTTTTTAGGGTGGCATATCTGTATTATAAATCCTGGTCTTCCATCTGGTGTTTTTGATG  360

Query  361  GAGGGACATATTTCTCAATTCCTGCTTCTGCTGGACACATTATAACTGAACAACCAAAAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361  GAGGGACATATTTCTCAATTCCTGCTTCTGCTGGACACATTATAACTGAACAACCAAAAC  420

Query  421  CTGTTGCCTCTGTAGCTGCAATCTTAGCCCACTTCTTTGTAGCTGCTGTTATTAAAACTC  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  421  CTGTTGCCTCTGTAGCTGCAATCTTAGCCCACTTCTTTGTAGCTGCTGTTATTAAAACTC  480

Query  481  TTGAAACCCATATTGGGAATGCTTCTGCAAATGTATCTTCAATATATACTCCATTTATTT  540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  481  TTGAAACCCATATTGGGAATGCTTCTGCAAATGTATCTTCAATATATACTCCATTTATTT  540

Query  541  CCATAGTTTCCCTCCATTAAGATTTTAACAATTATAGTTTATCTTAGGGGCTATTAATAT  600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  541  CCATAGTTTCCCTCCATTAAGATTTTAACAATTATAGTTTATCTTAGGGGCTATTAATAT  600

Query  601  CTTATCATTTGGtttttaatattcgataaatccataaataaaaatatatcaacaataatt  660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  601  CTTATCATTTGGTTTTTAATATTCGATAAATCCATAAATAAAAATATATCAACAATAATT  660

Query  661  ttaaataatctaagtataggtaatataacaattaaaaaGATTTAGAGGGATAGAATTGAA  720
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  661  TTAAATAATCTAAGTATAGGTAATATAACAATTAAAAAGATTTAGAGGGATAGAATTGAA  720

Query  721  CGGCATTAGGAGAATTGTTTTAGATATATTGAAGCCGCATGAGCCAAAAATAACAGATAT  780
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  721  CGGCATTAGGAGAATTGTTTTAGATATATTGAAGCCGCATGAGCCAAAAATAACAGATAT  780

Query  781  GGCATTAAAATTAACATCATTATCAAACATTGATGGGGTTAATATTACAGTCTATGAAAT  840
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  781  GGCATTAAAATTAACATCATTATCAAACATTGATGGGGTTAATATTACAGTCTATGAAAT  840

Query  841  AGATAAAGAGACTGAGAATGTTAAAGTTACAATTGAAGGGAATAATTTAGATTTTGATGA  900
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  841  AGATAAAGAGACTGAGAATGTTAAAGTTACAATTGAAGGGAATAATTTAGATTTTGATGA  900

Query  901  GATTCAGGAAATTATTGAAAGTTTGGGAGGGACTATTCACAGTATAGATGAGGTTGTTGC  960
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  901  GATTCAGGAAATTATTGAAAGTTTGGGAGGGACTATTCACAGTATAGATGAGGTTGTTGC  960

Query  961  AGGTAAAAAGATTATTGAAGAAGTTAGAACACCACAAGAT  1000
            ||||||||||||||||||||| ||||||||||||||||||
Sbjct  961  AGGTAAAAAGATTATTGAAGA-GTTAGAACACCACAAGAT  999

 

Query=  ERCC-00004_genbank |103488699|gb|DQ516752.1| Methanocaldococcus
jannaschii spike-in control MJ-500-35 genomic sequence
Length=500

Subject=  ERCC-00004
Length=523


Score =  917 bits (496),  Expect = 0.0
Identities = 499/500 (99%), Gaps = 1/500 (0%)
Strand=Plus/Plus

Query  1    TCTTGCTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAG  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1    TCTTGCTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAG  60

Query  61   CATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGA  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61   CATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGA  120

Query  121  CAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATC  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121  CAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATC  180

Query  181  CGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181  CGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCC  240

Query  241  CACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGTTTAAATTGACATCTTCATA  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241  CACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGTTTAAATTGACATCTTCATA  300

Query  301  AGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTC  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  301  AGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTC  360

Query  361  TAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGTAGATAAAATCAC  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361  TAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGTAGATAAAATCAC  420

Query  421  CGGCTTGCCTGTTTTTGCCACTTTTTCTAATAAGGGATAAAAGGTTAAATCACCAGAGGC  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  421  CGGCTTGCCTGTTTTTGCCACTTTTTCTAATAAGGGATAAAAGGTTAAATCACCAGAGGC  480

Query  481  AATTTTAAATGCAGGCACAT  500
            |||||||||| |||||||||
Sbjct  481  AATTTTAAAT-CAGGCACAT  499

 


Query=  ERCC-00007_genbank |116733904|gb|EF011068.1| Synthetic construct
spike-in microarray control hypothetical protein (ysdC) gene,
complete cds
Length=1121

 

Score = 2052 bits (1111),  Expect = 0.0
Identities = 1111/1111 (100%), Gaps = 0/1111 (0%)
Strand=Plus/Plus

Query  10    TTTATTGGTACGTAATTTCGTCAACCGTTTTTCGGTCTAACTTCTTAATGACTTCTGTAA  69
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1     TTTATTGGTACGTAATTTCGTCAACCGTTTTTCGGTCTAACTTCTTAATGACTTCTGTAA  60

Query  70    TTAACTTTACCGCGTTTTCATAATCATCACGATGCAGCATGGCCGCGTGCGTATGAATGT  129
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  61    TTAACTTTACCGCGTTTTCATAATCATCACGATGCAGCATGGCCGCGTGCGTATGAATGT  120

Query  130   AGCGGGTTGCAATGGTAATGGACAGCGCAGGAACGCCATTTGCCGTCAAATGGATGGCAC  189
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  121   AGCGGGTTGCAATGGTAATGGACAGCGCAGGAACGCCATTTGCCGTCAAATGGATGGCAC  180

Query  190   CCGAATCAGTTCCGCCGCCGGCAATGGCATCAAATTGGTACGGAATGCCGGCTTCCTCCG  249
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  181   CCGAATCAGTTCCGCCGCCGGCAATGGCATCAAATTGGTACGGAATGCCGGCTTCCTCCG  240

Query  250   CAGTGGCTACAACTGCATCGCGCAAACCTTTGTGAGAGACCATGGATGCATCGTAAACGA  309
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  241   CAGTGGCTACAACTGCATCGCGCAAACCTTTGTGAGAGACCATGGATGCATCGTAAACGA  300

Query  310   TAATCTGCGGGCCTTTGCCCATTTTGCTCTGCGCTTCCTTCTCGGAAATGCCAGGCGTGT  369
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  301   TAATCTGCGGGCCTTTGCCCATTTTGCTCTGCGCTTCCTTCTCGGAAATGCCAGGCGTGT  360

Query  370   CTCCTGCTATCCCTACATCAACACCAAACGCAATATCAGGCTGAATGGTGTGTGCAGCCG  429
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  361   CTCCTGCTATCCCTACATCAACACCAAACGCAATATCAGGCTGAATGGTGTGTGCAGCCG  420

Query  430   TTTTCGCTCCCCTCAGCCCGACTTCCTCCTGCACGGTTCCGACGCCATACACTATATTTG  489
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  421   TTTTCGCTCCCCTCAGCCCGACTTCCTCCTGCACGGTTCCGACGCCATACACTATATTTG  480

Query  490   GATGATCTGTGTTTTGTAAGTTTCTTAACACATCAATAGCAATCGCACAGCCGATGCGGT  549
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  481   GATGATCTGTGTTTTGTAAGTTTCTTAACACATCAATAGCAATCGCACAGCCGATGCGGT  540

Query  550   TGTCCCAGGCCTTTGCGAGTAGGAATTTTTCATTGTTCATGACCGTAAATTCAAAATGCG  609
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  541   TGTCCCAGGCCTTTGCGAGTAGGAATTTTTCATTGTTCATGACCGTAAATTCAAAATGCG  600

Query  610   GAACGATCATATCTCCCGGAAGTACACCCCACTCCAAGGCTTCTTCCCGGCTTGAAGCTC  669
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  601   GAACGATCATATCTCCCGGAAGTACACCCCACTCCAAGGCTTCTTCCCGGCTTGAAGCTC  660

Query  670   CAATATCAATAAACATGTCTTTTATTTCCACTGAtttttttCTTGCTTCAGGAGACAAAA  729
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  661   CAATATCAATAAACATGTCTTTTATTTCCACTGATTTTTTTCTTGCTTCAGGAGACAAAA  720

Query  730   TATGAGGCGGCTTAGATCCGATAACCCCTGTGATTTCTCCtttttttGTGACAATGGTGA  789
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  721   TATGAGGCGGCTTAGATCCGATAACCCCTGTGATTTCTCCTTTTTTTGTGACAATGGTGA  780

Query  790   CGCGCTGAGCAAGCATAACCTGAGCCCACCAGCCGCCAACGGTTTGAAAACGGATAAAGC  849
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  781   CGCGCTGAGCAAGCATAACCTGAGCCCACCAGCCGCCAACGGTTTGAAAACGGATAAAGC  840

Query  850   CTTTATCTGTGATTTGTGTCACCATAAAGCCGACTTCATCCAAATGTCCGGCGATCATAA  909
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  841   CTTTATCTGTGATTTGTGTCACCATAAAGCCGACTTCATCCAAATGTCCGGCGATCATAA  900

Query  910   TTTTCGGGCCGTTTTCTGCACCAGttttttttGCAATTAAACTGCCCAGGCGATCTGTTG  969
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  901   TTTTCGGGCCGTTTTCTGCACCAGTTTTTTTTGCAATTAAACTGCCCAGGCGATCTGTTG  960

Query  970   TCACCTCATCAGCAAATGGTTCTATGTATGATTTCATCACTTGCCTTACTTCTCTTTCAT  1029
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  961   TCACCTCATCAGCAAATGGTTCTATGTATGATTTCATCACTTGCCTTACTTCTCTTTCAT  1020

Query  1030  TGCCCGGTATGCCTTTTGCATCTGTTAAATCTTTCAGCATGGTCAATGTTTCATCTAATT  1089
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  1021  TGCCCGGTATGCCTTTTGCATCTGTTAAATCTTTCAGCATGGTCAATGTTTCATCTAATT  1080

Query  1090  TTGCCATGTTCCAAACCCTCCTTGAGCTCGG  1120
             |||||||||||||||||||||||||||||||
Sbjct  1081  TTGCCATGTTCCAAACCCTCCTTGAGCTCGG  1111

 


Query=  ERCC-00009_genbank |110339337|gb|DQ668364.1| Synthetic construct
clone TagJ microarray control
Length=960

Subject=  ERCC-00009
Length=984


Score = 1773 bits (960),  Expect = 0.0
Identities = 960/960 (100%), Gaps = 0/960 (0%)
Strand=Plus/Minus

Query  1    CAATGATAGGCTAGTCTCGCGCAGTACATGGTAGTTCAGCCAATAGATGCCTAGTACGCT  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  984  CAATGATAGGCTAGTCTCGCGCAGTACATGGTAGTTCAGCCAATAGATGCCTAGTACGCT  925

Query  61   GACGGCATTCAGAGTACGCTGATCGGCTTATGACGTATGTGACGCAGCTCTTAGCGCAAT  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  924  GACGGCATTCAGAGTACGCTGATCGGCTTATGACGTATGTGACGCAGCTCTTAGCGCAAT  865

Query  121  GTATGTGCTGTTATCGAAGCCTATGGCTGAGTATGTAACGCTATGGCGTGCTAGTCGTCT  180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  864  GTATGTGCTGTTATCGAAGCCTATGGCTGAGTATGTAACGCTATGGCGTGCTAGTCGTCT  805

Query  181  CATATACGTCTGATGACCTCGTATCATGTTATAGGGCTGCGAACTGTCGATGATGGTCAC  240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  804  CATATACGTCTGATGACCTCGTATCATGTTATAGGGCTGCGAACTGTCGATGATGGTCAC  745

Query  241  GACTCTGTCGATAGCTGTGTGACTCATTCAGAAGGTGTGCAGCCTATATGATACGCAGTC  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  744  GACTCTGTCGATAGCTGTGTGACTCATTCAGAAGGTGTGCAGCCTATATGATACGCAGTC  685

Query  301  GCATCCTATCTTACGTGTCAGTACTATGTGTGAGTGCTCCGCCCTAGTGCTGATGTATGC  360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  684  GCATCCTATCTTACGTGTCAGTACTATGTGTGAGTGCTCCGCCCTAGTGCTGATGTATGC  625

Query  361  CCCATAGTGCTCAGTGGAGTCTCTCTTAGCATAGTGTCCGCTCATACATTAGATGGACGG  420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  624  CCCATAGTGCTCAGTGGAGTCTCTCTTAGCATAGTGTCCGCTCATACATTAGATGGACGG  565

Query  421  CTCATTAGTATCATCGTCGGCTGATATAGGTCGTGGCTCCCTGTATATCGAGGTGAGTCT  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  564  CTCATTAGTATCATCGTCGGCTGATATAGGTCGTGGCTCCCTGTATATCGAGGTGAGTCT  505

Query  481  ATCTGGATCAACGTCGCACTATGATGTGCAAAGTGTCGTCCATGTATAGACAGTGCGCGT  540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  504  ATCTGGATCAACGTCGCACTATGATGTGCAAAGTGTCGTCCATGTATAGACAGTGCGCGT  445

Query  541  ATCATATAGGATGCGGCGATCTCATACAGCGTTACGGTCGCTGCGTACTGTATAAGGATG  600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  444  ATCATATAGGATGCGGCGATCTCATACAGCGTTACGGTCGCTGCGTACTGTATAAGGATG  385

Query  601  CTCTGTGAACTGTCATCGGTCCGATCAATTAGTCTAGTGTGCGTTATTCAGATCGAGTGA  660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  384  CTCTGTGAACTGTCATCGGTCCGATCAATTAGTCTAGTGTGCGTTATTCAGATCGAGTGA  325

Query  661  GTACATGATTCGTCAGTGTGGATCAATTACAGTTAGGCCGCTGACACATTAGTAACGTCG  720
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  324  GTACATGATTCGTCAGTGTGGATCAATTACAGTTAGGCCGCTGACACATTAGTAACGTCG  265

Query  721  GCAAGCACTTAGTCGTGTCGTAAGCCAGTGTGTCGTGTCTTAGACGACTGTGTGTGATTC  780
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  264  GCAAGCACTTAGTCGTGTCGTAAGCCAGTGTGTCGTGTCTTAGACGACTGTGTGTGATTC  205

Query  781  TCGAGCGATTTATACATCCGTGACAGCGTTTATAGTGTGCTGACAGACTGGTTGGTTATC  840
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  204  TCGAGCGATTTATACATCCGTGACAGCGTTTATAGTGTGCTGACAGACTGGTTGGTTATC  145

Query  841  CAATGATCGACCTGGAGTCTAATATCTGACCACGCCTTGTAATCGTATGACACGCGCTTG  900
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  144  CAATGATCGACCTGGAGTCTAATATCTGACCACGCCTTGTAATCGTATGACACGCGCTTG  85

Query  901  ACACGACTGAATCCAGCTTAAGAGCCCTGCAACGCGATATACAGGCGCTGCTACCGATAT  960
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  84   ACACGACTGAATCCAGCTTAAGAGCCCTGCAACGCGATATACAGGCGCTGCTACCGATAT  25

 

Query=  ERCC-00012_genbank |114976952|gb|DQ883670.2| Synthetic construct
clone NISTag29 external RNA control sequence
Length=1000

Subject=  ERCC-00012
Length=994


Score = 1836 bits (994),  Expect = 0.0
Identities = 994/994 (100%), Gaps = 0/994 (0%)
Strand=Plus/Plus

Query  1    CGAGAGATGTTTGTAGGTGCGGAATGTGTGCGGTCTACCTTAGCTGTA