Live Chat Support Software
800.227.0627

Speed-up Identification of COVID19

 

 Bio-Synthesis offers Primers, Probes and Standards to Researchers around the World to help combat the new Coronavirus SARS-CoV-2 (COVID19) and to speed up accurate diagnosis of the virus.

Available primer and probes

ID

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

 

 

CDC US

 

 

 

Nucleoprotein – N Protein

 

2019-nCoV_N1-F

 

GACCCCAAAATCAGCGAAAT

 

2019-nCoV_N1-R

 

TCTGGTTACTGCCAGTTGAATCTG

 

2019-nCoV_N1-P

FAM

ACCCCGCATTACGTTTGGTGGACC

BHQ1

2019-nCoV_N2-F

 

TTACAAACATTGGCCGCAAA

 

2019-nCoV_N2-R

 

GCGCGACATTCCGAAGAA

 

2019-nCoV_N2-P

FAM

ACAATTTGCCCCCAGCGCTTCAG

BHQ1

2019-nCoV_N3-F

 

GGGAGCCTTGAATACACCAAAA

 

2019-nCoV_N3-R

 

TGTAGCACGATTGCAGCATTG

 

2019-nCoV_N3-P

FAM

AYCACATTGGCACCCGCAATCCTG

BHQ1

 

 

HKU Med

 

 

 

Nucleoprotein – N Protein

 

HKU-NF

 

TAATCAGACAAGGAACTGATTA

 

HKU-NR

 

CGAAGGTGTGACTTCCATG

 

HKU-NP

FAM

GCAAATTGTGCAATTTGCGG

TAMRA

         

 

 

 

CDC China

 

 

 

Nucleoprotein - N Protein

 

2019-nCoV-NFP

 

GGGGAACTTCTCCTGCTAGAAT

 

2019-nCoV-NRP

 

CAGACATTTTGCTCTCAAGCTG

 

2019-nCoV-NP

FAM

TTGCTGCTGCTTGACAGATT

TAMRA

 

   

CDC China

 
 

 

ORF1ab

 

2019-nCoV-OFP

 

CCCTGTGGGTTTTACACTTAA

 

2019-nCoV-ORP

 

ACGATTGTGCATCAGCTGA

 

2019-nCoV-OP

FAM

CCGTCTGCGGTATGTGGAAAGGTTATGG

BBQ1

 

 

 

HKU Med

.

 

 

ORF1b-nsp14

 

HKU-ORF1b-nsp14F

 

TGGGGYTTTACRGGTAACCT

 

HKU- ORF1b-nsp14R

 

AACRCGCTTAACAAAGCACTC

 

HKU-ORF1b-nsp141P

FAM

TAGTTGTGATGCWATCATGACTAG

TAMRA


ID

Label 5’

Oligonucleotide Sequence (5’>3’)

Label 3’

 

 

CDC

 

 

 

RNAse Protein

 

RP-F

 

AGATTTGGACCTGCGAGCG

 

RP-R

 

GAGCGGCTGTCTCCACAAGT

 

RP-P RNAse P

FAM

TTCTGACCTGAAGGCTCTGCGCG

BHQ-1

 
Others

 

 

ORF1b-nsp14

 

HKU-ORF1b-nsp14F

 

TGGGGYTTTACRGGTAACCT

 

HKU- ORF1b-nsp14R

 

AACRCGCTTAACAAAGCACTC

 

HKU-ORF1b-nsp141P

FAM

TAGTTGTGATGCWATCATGACTAG

TAMRA


 

References

CDC - US Centers for Disease Control and Prevention. (2020, February 4). Real-time RT-PCR panel for detection 2019-novel coronavirus.

Charite Virology - Corman et al. (2020, January 17). Diagnostic detection of 2019-nCoV by real-time RT-PCR.

CDC China - National Institute For Viral Disease Control and Prevention. (2020, January 21). Specific primers and probes for detection 2019 novel coronavirus.

HKU Med Protocol

World Health Organization (WHO)

---...---